TFome Information for pUT5422

TFome Name:pUT5422
Genbank Insert ID:KJ727562
Protein Name:ZmbZIP12
Species: Maize
TF Family: bZIP
Template: BT068578.1
Corresponding TF Gene: GRMZM2G448607
Transcript: T01

5' Primer Name: B544_F 3' Primer Name: B544_R
5' Primer Sequence: caccATGTCGTCGTCACGCCG 3' Primer Sequence: GAACCCGATGGGCTGCATCG
5' Primer Tm (º C): 63.1 3' Primer Tm (º C): 61.3
PCR Condition: PCR Reaction Mix: 5 l GC buffer (NEB) 1 l primer forward 20mM 1 l primer reverse 20mM 5 l glycerol 50% 1 l DNA template (c=1 ng/l) 1 l MgCl2 50mM 1 l dNTPs 10mM 0.25 l phusion taq (NEB M0530L, now replaced by F-530) 10.75 l ultrapure water PCR program: 40 sec 98°C 30x : 15 sec 98°C 30 sec 58°C 30 sec 72°C 7 min 72°C leave at 4°C
TFome clones do not contain stop codon at 3'end.
Request Information: Deposited to ABRC.
PI responsible for TF ORF clone synthesis: Erich Grotewold <>
Plasmid Map