TFome Information for pUT1147

TFome Name pUT1147
Template AM156904
Genbank Insert ID HQ858691
Protein Name ZmMYB9
Species Maize
TF Family MYB
Gene ID GRMZM2G081557
transcript T01
Vector pENTR/D-TOPO
Note c.Start+120
Request Information: Deposited to ABRC
5' Primer Name: D1 UP 3' Primer Name: D1 DN
5' Primer Tm (º C): 63.0 3' Primer Tm (º C):
5' Primer Sequence: CAC CAT GGG GAG GTC CCC G 3' Primer Sequence: TAGTGGCAGGCTGAAGCTgc
PCR Condition: Step 1, 98C 30 sec melt, 1 cycle; Step 2, 98C 10 s
Nucleotide Sequence: ATGGGGAGGTCCCCGTGCTGCTGCCACGACGCCGGCGTCAAGAAAGGCCCGTGGACGGAGGAGGAGGACCGCGCCCTGGTGGACCACATCCAGAGGCACGGCGGCCACGTCAGCAGCTGGCGCAACCTGCCCAAGGCCGCCGGGCTCAACCGCTGCGGCAAGAGCTGCCGCCTCCGCTGGACCAACTACCTCCGCCCCGACATCAAGCGCGGCAACTTCACCGACGACGAGGAGCGCCTCATCATCGGCCTCCATGCCCAGCTCGGTAACAGGTGGTCGACGATCGCGACGCACCTGGACGGGCGGACGGACAACGAGATCAAGAACTACTGGAACACGCACATCCGCAAGAAGCTGCTGCGCATGGGCGTCGACCCCGTCACGCACCAGCGCCTGCCCCCCGACGACCTGCTGCTCGCCGTCTCCGCCTCCCCCACGACGACGATCCTCTCGGCGGCGGCGAGCCAGCTGCGGGGCCTGAACACCGCTCTCATGCAGGTGCAAGCGCTGCAGTTTCTGCTGCAGGCCGTCAGTGGAGTTGGAAACGACGTTAACGCCGCCGCCGCTGCTGCTAATGGTGGTGGTGGTCTCGTCCCTAGCCTCAGCGCAGCCGCAGATAATAACGCCGTTCTGAACGCGAGCCGTAGCGTCGTTCCAGGCTTCCAGGACCTGCAGCTGACGACGATGACCAGGCCTCTTCTCGTGTCTCACGCGAATCACGGGTCAGCTGATCATCATCCCAGCTACATCGCAACTGATGATGTGGTGCAGCGACGACTGAACGCTTCGGCTCCTCCGGTGGTCGGCGGCGGCGCCTGTGCAGAGCCGCTGGCTGTTGCATTGGCGTCCACGGCTTATCGACACCAAGTGGCAGCTGCCGCTGACGAGCCGGTGAATGGTTTTGCCGAGCTAATACTGTCGGAGCCCATCGAGATGCCGAGCATGTGCTCTCTGGAGGACGAAGATCATTTCTGGAAGGACATGCTCGTAGAGAGCAGCAGCTTCAGCCTGCCACTA
TFome clones do not contain stop codon at 3'end.
translation: MGRSPCCCHDAGVKKGPWTEEEDRALVDHIQRHGGHVSSWRNLPKAAGLNRCGKSCRLRWTNYLRPDIKRGNFTDDEERLIIGLHAQLGNRWSTIATHLDGRTDNEIKNYWNTHIRKKLLRMGVDPVTHQRLPPDDLLLAVSASPTTTILSAAASQLRGLNTALMQVQALQFLLQAVSGVGNDVNAAAAAANGGGGLVPSLSAAADNNAVLNASRSVVPGFQDLQLTTMTRPLLVSHANHGSADHHPSYIATDDVVQRRLNASAPPVVGGGACAEPLAVALASTAYRHQVAAAADEPVNGFAELILSEPIEMPSMCSLEDEDHFWKDMLVESSSFSLPL