TFome Information for pUT1149

TFome Name pUT1149
Genbank Insert ID HQ858693
Protein Name ZmMYB39
Species Maize
TF Family MYB
Gene ID GRMZM2G127857
transcript T01
Vector pENTR/D-TOPO
Note c.G6C p.(=); PZE04141737314 c.C80T p.A27V; c.C352G p.P118A; PZE04141737942 c.A355C p.K119Q; PZE04141737945 c.A453G p.(=); PZE04141738043 c.G469T p.A157S; c.G501A p.(=); PZE04141738091 c.C529G p.P177A; PZE04141738119 c.G554A p.G185D; PZE04141738144 c.C567A p.(=); PZE04141738157 c.C621G p.(=); PZE04141738211 c.A682G c.A683C p.K228A; c.408del12. Clone is from inbred line W64, obtained from David Capparos. Present in template FlcDNA.
Request Information: Deposited to ABRC
5' Primer Name: D3 UP 3' Primer Name: D3 DN
5' Primer Tm (º C): 61.6 3' Primer Tm (º C):
5' Primer Sequence: CAC CAT GGG CCG CTC TCC 3' Primer Sequence: AATAATCTGGGGCAAATTctgc
PCR Condition: Step 1, 98C 30 sec melt, 1 cycle; Step 2, 98C 10 s
Nucleotide Sequence: ATGGGCCGCTCTCCGTGCTGCGAGAAGATGGGGCTGAAGAGGGGTCCGTGGACGGCCGAGGAGGACAGGATTCTGGTGGTGCACGTCGAGCGCCACGGCCACAGCAACTGGCGCGCGCTGCCCAAGCAGGCGGGCCTGCTCCGCTGCGGCAAGAGCTGCCGCCTCCGCTGGATCAACTACCTGCGCCCCGACATCAAGCGCGGCAACTTCAGCCGGGAGGAGGAGGACGCCATCATACAGCTCCACCAAATGCTCGGCAACAGATGGTCGACAATCGCTGCCAGGCTGCCGGGGAGGACGGACAACGAGATCAAGAACGTCTGGCACACCCACCTCAAGAAGCGCCTGGAGGCACAGCCAGCCAGCCAGCAGGCGCCCAAGCGCAAGCCCACGAAGAAGCAGCAGCCCGAGCCCGTAACGACGCTCGAGGGGCCGGCCGGGGCCGTGCCGCCGGTGTCGCCGGAGCGGTCACTCTCCACGACGACGTCAACCACCACCAGCACCGCGGACTACTCGGCCGCCTCGTCGCTGGAGAACGCGGACGACAGCTTCACATCGGAGGAGGACTACTACCAGATCGACGACAGCTTCTGGTCCGAGACGCTGGCGATGACGACGACGGTGGACAGCTTCGAGTCCGGGGTGCAGCAGGCGGAGGGCAGCTTCGGCGCGTCGGCGGCGGCGCCGTCGTCGACCAACGACGACATGGACTTCTGGCTCAAGCTGTTCATGCAGGCCAGCGACATGCAGAATTTGCCCCAGATTATT
TFome clones do not contain stop codon at 3'end.
translation: MGRSPCCEKMGLKRGPWTAEEDRILVVHVERHGHSNWRALPKQAGLLRCGKSCRLRWINYLRPDIKRGNFSREEEDAIIQLHQMLGNRWSTIAARLPGRTDNEIKNVWHTHLKKRLEAQPASQQAPKRKPTKKQQPEPVTTLEGPAGAVPPVSPERSLSTTTSTTTSTADYSAASSLENADDSFTSEEDYYQIDDSFWSETLAMTTTVDSFESGVQQAEGSFGASAAAPSSTNDDMDFWLKLFMQASDMQNLPQII