TFome Information for pUT1177

TFome Name pUT1177
Genbank Insert ID HQ858718
Protein Name ZmMYB27
Species Maize
TF Family MYB
Gene ID GRMZM2G064744
transcript T01
Vector pENTR/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: C18 UP 3' Primer Name: C18 DN
5' Primer Tm (º C): 65.2 3' Primer Tm (º C):
5' Primer Sequence: caccATGGGGCGCGAGGC 3' Primer Sequence: GAGGAAGTCGACGCTGAA
PCR Condition: Step 1, 98C 30 sec melt, 1 cycle; Step 2, 98C 10 s
Nucleotide Sequence: ATGGGGCGCGAGGCGGCAGCCACGAGGCCGCCCAAGCTGCGGAGGGGCCTGTGGTCGCCGGAGGAGGACGAGAAGCTGTACAATCACATCATCCGATATGGCGTCGGCTGCTGGAGCTCAGTCCCAAAGCTCGCTGGCTTGGAGAGATGCGGCAAGAGCTGCAGGCTGAGATGGATCAACTACCTGCGGCCTGACCTCAAGAGGGGCAGCTTCTCCCAGCAGGAGGAGGATCTCATCGTCAGCCTCCACAAGATACTAGGCAACAGGTGGTCCCAGATCGCGTCGCAGCTGCCGGGGAGGACGGACAACGAGATCAAAAACTTCTGGAACTCGTGCATCAAGAAGAAGCTCCGGCAGCAGGGCATCGACCCCGCCACCCACAAGCCGCTCAACGACGACGACAACGCTGCTGCTGCTGCTGCTGCGGACAACGACGCCGCCGTGGCGCCGCACCACCATCGTCGTCATCAGGACGACCACTGCGGCGCCGCCAATATTGATAATAATAATAATAACAACAACAACAACAACAATCGGCAGCTCCCCTCAGCCGACGACCACTGCTTCGCCATGAGCAGCGACGACCCTCTCGCGCCACACTCCCCGACCGTCAGCTTCGACCCACTGTCCGTCACCAACGTCCCCACGGCAATGCAGCAGGGCTCCTACGGCTCGTTCCGCTCCGACAACGACCACCTCTGCGACTACGGCGGCGGCGGCGTCGACGTGGTCTCGGACGCCGCCACGGCGTACAGCGCCCCCTACACAGGCGGCGGCGGCGGCGGCGGAGACAGCTCCAGCAACAGCAACGGCAACGGCACCTGGGCCTGCAGCGGCGGCGAGCCGATGCCGCCGCACGTGGCCATGTTCGGCCGCGATGCTGCCCAGGCGGCGGCGTACCATCAGTTCGTCGACCCGGCCAAGTACAGCCCCTGGCAGCAGCACCCGGCGGCGAGGCTCCATGATCACAACGTCGGCGGCGCTGCTGCGGGCTTCCCGATACGGTCCATGTCGCGGGACCTGCCGGGTTCCTGCTTCGACCTCGCCCGCAGCGCGCTGGAGGACGAGTTCAGCGTCGACTTCCTC
TFome clones do not contain stop codon at 3'end.
translation: MGREAAATRPPKLRRGLWSPEEDEKLYNHIIRYGVGCWSSVPKLAGLERCGKSCRLRWINYLRPDLKRGSFSQQEEDLIVSLHKILGNRWSQIASQLPGRTDNEIKNFWNSCIKKKLRQQGIDPATHKPLNDDDNAAAAAAADNDAAVAPHHHRRHQDDHCGAANIDNNNNNNNNNNNRQLPSADDHCFAMSSDDPLAPHSPTVSFDPLSVTNVPTAMQQGSYGSFRSDNDHLCDYGGGGVDVVSDAATAYSAPYTGGGGGGGDSSSNSNGNGTWACSGGEPMPPHVAMFGRDAAQAAAYHQFVDPAKYSPWQQHPAARLHDHNVGGAAAGFPIRSMSRDLPGSCFDLARSALEDEFSVDFL