TFome Information for pUT1508

TFome Name pUT1508
Template
Genbank Insert ID HQ858840
Protein Name OsMYBR70
Species Rice
TF Family MYB-related
Gene ID LOC_Os08g39980
transcript
Vector pENTR/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: 3' Primer Name:
5' Primer Tm (º C): 0.0 3' Primer Tm (º C): 0.0
5' Primer Sequence: 3' Primer Sequence:
PCR Condition:
Nucleotide Sequence: ATGACCGCCAGATCGGGCGACCCCGGCGTCTCGCCGGAGTCGTCGTCTGCGGCGGCGGCGGCGGCGGGGTCCGGGGGCGGGGAGATCTGGGGGACGTCGGAGGACCTGCTCCTGGCGTGCGCCGTGAGCCGCCATGGGACGGCGAGCTGGGACGCGGTGGCGAAGGAGATGCAGTCGAGGTGCCCTTCCGCCGCCGTGTTCACCCCCACCACCTGCCGCCTCCGGTTCCGCGTCCTCCACCGCCGGTTCTCCGGCGGCGTCACCGCCGAGAACGAGGACGCCGACGGCGGCGAGGAGGAGGAAGAGGCCGACGCCGCCGCCGTCGCCGGCTGGGTGGAGGAACTCCGCGAGCTGCGCGTCGCCGAGCTCCGCCGCGAGGTCGAGAAATACGATCTCTCGATCGGGTCGTTGCAATCAAAAGTGAAACGGCTCAAGGAGGAGAGGGAAAAGAGCATCTCCGGCGAGACGAAGCCGCCGCCGGCGGCGGCGGCGGTGAAGGAGGAGGAGGAGGATGTACGGAAGGGATCACCGGAGGAGGCCGGCGCCGTGGAGGACAGGGTCTCCGGCCACGAATCCGGCCGGTCATGCAAGGAGTCGAACTCGTCAGATCTGAAGCGGCCGGAGAACGACCCCGCGGTCGCCGACGACGACGACCGGGAGGCGGAGGAGGAGGAGGAGGCGGCGGCGGCGCCCGCGGCCGGCGACATCGCCGTGAAGGAGGAGGCGTCGGGCGAGTCGGTGGCTGGGTCGAAGGAGGCGGACGTCGAGAAGGAGAGCAGCGACGTGCAGAGCTCCGCCAGCCCGTCCCGCCGCCGGCGACGGAAGGGCGGAGGCGGCGGCGAAGAGGCGGAGGCGGCGTCGCCGTCGGTGTCCGTGCCCCTCCCCGCCGCCGAGGCCGAGCCGCTCGTCGCCTTCCTCGAGTCGGTCCGGACCAGCAAGGCCGGCGCCGTGTTCGAGCGGCGGCTCGATAGCCAGGATGGGGAGAGGTACAGTGGCACGATCAGGCGCCATGTGGACCTGGAGACGGTCAGGTCGAGGCTGGTGGGTGCAACGGCGGCGGCGGCGGCGGCGGCGTGCTACGCGTCGGCGTCCGAGTTCTACCGCGACATGATGCTGCTCTGCGCCAACGCGCTCGTCTTCTTCCCGCGCGGCTCGCCGGAGCACGCCGCCGCGCTCCAGCTGCGCGCGCTCGTCTCCAAGCAGGTCTCCAAGGACCGGCAGCCTCACGCCGGGGCGAAGGCCCCCGCGGCGGCGGCGGAGGAGGAGGAGAAGAAGAAGCCGGCCAAGGCCGACGCCGACATCGCTGGGCCGCTGCTCGAGAAGGCGCCGATCATCGTCTGCCGGAAGCGGAGCTCCATCGCGAAGGCCGCGGCGGCGGCTGCCAAGGGGGAGAAGGCGGAGAAGGCAGAGACGGACAAGAAGGAGAAGGACGGCAGCGAGGAGAAGAAGAAGGCTGCGGCGGCAGCGACGACGGCGACGGCGGCGGCCACTGCCAAGGACAAGAAGGCTCGGGGCATGAGGACGAACAAGAGCCGGGGACCCGCGAGGAATCAGAAGACGGCGAAGCTCTCGGAGACCGGCGAGGGGACCAAGAAGTCCGACAAGAAGGGCGGCGGCGGAGGCGGCAGCTCTTCGGCAGGGGCGGCGGCGGGCGGGGTTGCCAAGAAGCGAAACGCCGTGGATTTCCTGAACCGGATGAACCAGAACGGCTCGCCGTCGACGGAGAGGGTGTCGTTGCTGGAGACGCTGAAGCTCTCCGCGGCGGCGACGGAGCAGCAGAAGAAGTCGTCGTCGTCGTCATCCGGGAAGGGCGACGGCCGGAAGGAGGCCGGCGGCTCAGGCTCCAAGAAGGGCGCCGCCGCCTCGACGCCACCAGGGAGGAGGATCGGTCGGCCACCGAAGCGGGCGGCCGCGCCGCCGACGCCGCCGCCGTCCAAGAGGGCCAAGGACGACAAGCCGACCAGGAAGCGCGGGAAGAAG
TFome clones do not contain stop codon at 3'end.
translation: MTARSGDPGVSPESSSAAAAAAGSGGGEIWGTSEDLLLACAVSRHGTASWDAVAKEMQSRCPSAAVFTPTTCRLRFRVLHRRFSGGVTAENEDADGGEEEEEADAAAVAGWVEELRELRVAELRREVEKYDLSIGSLQSKVKRLKEEREKSISGETKPPPAAAAVKEEEEDVRKGSPEEAGAVEDRVSGHESGRSCKESNSSDLKRPENDPAVADDDDREAEEEEEAAAAPAAGDIAVKEEASGESVAGSKEADVEKESSDVQSSASPSRRRRRKGGGGGEEAEAASPSVSVPLPAAEAEPLVAFLESVRTSKAGAVFERRLDSQDGERYSGTIRRHVDLETVRSRLVGATAAAAAAACYASASEFYRDMMLLCANALVFFPRGSPEHAAALQLRALVSKQVSKDRQPHAGAKAPAAAAEEEEKKKPAKADADIAGPLLEKAPIIVCRKRSSIAKAAAAAAKGEKAEKAETDKKEKDGSEEKKKAAAAATTATAAATAKDKKARGMRTNKSRGPARNQKTAKLSETGEGTKKSDKKGGGGGGSSSAGAAAGGVAKKRNAVDFLNRMNQNGSPSTERVSLLETLKLSAAATEQQKKSSSSSSGKGDGRKEAGGSGSKKGAAASTPPGRRIGRPPKRAAAPPTPPPSKRAKDDKPTRKRGKK