TFome Information for pUT1508

TFome NamepUT1508
Genbank Insert IDHQ858840
Protein NameOsMYBR70
Species Rice
TF Family MYB-related
Gene ID LOC_Os08g39980
transcript
VectorpENTR/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: 3' Primer Name:
5' Primer Tm (º C): 0.0 3' Primer Tm (º C): 0.0
5' Primer Sequence: 3' Primer Sequence:
PCR Condition:
Nucleotide Sequence: ATGACCGCCAGATCGGGCGACCCCGGCGTCTCGCCGGAGTCGTCGTCTGCGGCGGCGGCGGCGGCGGGGTCCGGGGGCGGGGAGATCTGGGGGACGTCGGAGGACCTGCTCCTGGCGTGCGCCGTGAGCCGCCATGGGACGGCGAGCTGGGACGCGGTGGCGAAGGAGATGCAGTCGAGGTGCCCTTCCGCCGCCGTGTTCACCCCCACCACCTGCCGCCTCCGGTTCCGCGTCCTCCACCGCCGGTTCTCCGGCGGCGTCACCGCCGAGAACGAGGACGCCGACGGCGGCGAGGAGGAGGAAGAGGCCGACGCCGCCGCCGTCGCCGGCTGGGTGGAGGAACTCCGCGAGCTGCGCGTCGCCGAGCTCCGCCGCGAGGTCGAGAAATACGATCTCTCGATCGGGTCGTTGCAATCAAAAGTGAAACGGCTCAAGGAGGAGAGGGAAAAGAGCATCTCCGGCGAGACGAAGCCGCCGCCGGCGGCGGCGGCGGTGAAGGAGGAGGAGGAGGATGTACGGAAGGGATCACCGGAGGAGGCCGGCGCCGTGGAGGACAGGGTCTCCGGCCACGAATCCGGCCGGTCATGCAAGGAGTCGAACTCGTCAGATCTGAAGCGGCCGGAGAACGACCCCGCGGTCGCCGACGACGACGACCGGGAGGCGGAGGAGGAGGAGGAGGCGGCGGCGGCGCCCGCGGCCGGCGACATCGCCGTGAAGGAGGAGGCGTCGGGCGAGTCGGTGGCTGGGTCGAAGGAGGCGGACGTCGAGAAGGAGAGCAGCGACGTGCAGAGCTCCGCCAGCCCGTCCCGCCGCCGGCGACGGAAGGGCGGAGGCGGCGGCGAAGAGGCGGAGGCGGCGTCGCCGTCGGTGTCCGTGCCCCTCCCCGCCGCCGAGGCCGAGCCGCTCGTCGCCTTCCTCGAGTCGGTCCGGACCAGCAAGGCCGGCGCCGTGTTCGAGCGGCGGCTCGATAGCCAGGATGGGGAGAGGTACAGTGGCACGATCAGGCGCCATGTGGACCTGGAGACGGTCAGGTCGAGGCTGGTGGGTGCAACGGCGGCGGCGGCGGCGGCGGCGTGCTACGCGTCGGCGTCCGAGTTCTACCGCGACATGATGCTGCTCTGCGCCAACGCGCTCGTCTTCTTCCCGCGCGGCTCGCCGGAGCACGCCGCCGCGCTCCAGCTGCGCGCGCTCGTCTCCAAGCAGGTCTCCAAGGACCGGCAGCCTCACGCCGGGGCGAAGGCCCCCGCGGCGGCGGCGGAGGAGGAGGAGAAGAAGAAGCCGGCCAAGGCCGACGCCGACATCGCTGGGCCGCTGCTCGAGAAGGCGCCGATCATCGTCTGCCGGAAGCGGAGCTCCATCGCGAAGGCCGCGGCGGCGGCTGCCAAGGGGGAGAAGGCGGAGAAGGCAGAGACGGACAAGAAGGAGAAGGACGGCAGCGAGGAGAAGAAGAAGGCTGCGGCGGCAGCGACGACGGCGACGGCGGCGGCCACTGCCAAGGACAAGAAGGCTCGGGGCATGAGGACGAACAAGAGCCGGGGACCCGCGAGGAATCAGAAGACGGCGAAGCTCTCGGAGACCGGCGAGGGGACCAAGAAGTCCGACAAGAAGGGCGGCGGCGGAGGCGGCAGCTCTTCGGCAGGGGCGGCGGCGGGCGGGGTTGCCAAGAAGCGAAACGCCGTGGATTTCCTGAACCGGATGAACCAGAACGGCTCGCCGTCGACGGAGAGGGTGTCGTTGCTGGAGACGCTGAAGCTCTCCGCGGCGGCGACGGAGCAGCAGAAGAAGTCGTCGTCGTCGTCATCCGGGAAGGGCGACGGCCGGAAGGAGGCCGGCGGCTCAGGCTCCAAGAAGGGCGCCGCCGCCTCGACGCCACCAGGGAGGAGGATCGGTCGGCCACCGAAGCGGGCGGCCGCGCCGCCGACGCCGCCGCCGTCCAAGAGGGCCAAGGACGACAAGCCGACCAGGAAGCGCGGGAAGAAG
TFome clones do not contain stop codon at 3'end.
translation: MTARSGDPGVSPESSSAAAAAAGSGGGEIWGTSEDLLLACAVSRHGTASWDAVAKEMQSRCPSAAVFTPTTCRLRFRVLHRRFSGGVTAENEDADGGEEEEEADAAAVAGWVEELRELRVAELRREVEKYDLSIGSLQSKVKRLKEEREKSISGETKPPPAAAAVKEEEEDVRKGSPEEAGAVEDRVSGHESGRSCKESNSSDLKRPENDPAVADDDDREAEEEEEAAAAPAAGDIAVKEEASGESVAGSKEADVEKESSDVQSSASPSRRRRRKGGGGGEEAEAASPSVSVPLPAAEAEPLVAFLESVRTSKAGAVFERRLDSQDGERYSGTIRRHVDLETVRSRLVGATAAAAAAACYASASEFYRDMMLLCANALVFFPRGSPEHAAALQLRALVSKQVSKDRQPHAGAKAPAAAAEEEEKKKPAKADADIAGPLLEKAPIIVCRKRSSIAKAAAAAAKGEKAEKAETDKKEKDGSEEKKKAAAAATTATAAATAKDKKARGMRTNKSRGPARNQKTAKLSETGEGTKKSDKKGGGGGGSSSAGAAAGGVAKKRNAVDFLNRMNQNGSPSTERVSLLETLKLSAAATEQQKKSSSSSSGKGDGRKEAGGSGSKKGAAASTPPGRRIGRPPKRAAAPPTPPPSKRAKDDKPTRKRGKK