TFome Information for pUT1611

TFome NamepUT1611
Genbank Insert IDHQ858848
Protein NameOsWRKY73
Species Rice
TF Family WRKY
Gene ID LOC_Os07g48260
Request Information: Deposited to ABRC
5' Primer Name: 3' Primer Name: R246DN
5' Primer Tm (º C): 58.2 3' Primer Tm (º C): 57.6
5' Primer Sequence: caccatggcgtctcctgatg 3' Primer Sequence: aggatcgaagccaaacatgtcg
PCR Condition: Step 1, 98C 30 sec melt, 1 cycle; Step 2, 98C 10 s
TFome clones do not contain stop codon at 3'end.