TFome Information for pUT1663

TFome Name pUT1663
Genbank Insert ID HQ858763
Protein Name ZmMYB36
Species Maize
TF Family MYB
Gene ID GRMZM2G169316
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: B56 UP 3' Primer Name: B56 DN
5' Primer Tm (º C): 64.0 3' Primer Tm (º C):
5' Primer Sequence: CAC CAT GTC GGC CGC CGA AAC 3' Primer Sequence: GGT TGG TGG AAT TGA TTG CAT CAA GT
PCR Condition: Step 1, 98C 30 sec melt, 1 cycle; Step 2, 98C 10 s
Nucleotide Sequence: ATGTCGGCCGCCGAAACCGCTGTTTCTCCGACGACGACGCCGCAGCCGCAGCTGCAATCGGATCCGAACGCCGCCGCCGACGCGGCCAGTTCCAATTCTCTCTGGGTGGCCGACGAGACGCAAACCCTAACCGAGGTCCTGCTCCAACCCCAACCAAACCACCTGTCGCCTCCTCCTTCTGGTGAAGGGGACGACGGGATCACTGCCTCCGGTGCTCCTGTTGGTGGGGACGCCGCGGCATCTGCTTCTGCTGCGGCGGCGGCTAACGCGACGATAGAAGAGCGGGTGAGGGGGCCGTGGTCCCCAGAGGAGGACGCGGTGCTGAGCAACCTCGTGGAGAAGTTCGGGGCGCGGAACTGGACGCTGATCGCGCGTGGCATCCCGGGCCGCTCCGGCAAGTCCTGCCGCCTGCGCTGGTGCAATCAGCTCGACCCCCAAGTCAAGCGCAAGCCTTTCACTGAAGAGGAGGACCGCATTATAATGGCAGCTCATGCTGTCCATGGGAACAAGTGGGCATCTATCGCAAAGCTTTTGGATGGGAGAACAGACAATGCCATCAAGAATCACTGGAATTCCACCCTGAGGCGTCGCTACTGCAATGATGGCCAATGCAAGCATGGTGGTTCTGTGGAGCGAAGTATCCCAAAGGTGTCCAGGGAAGTTTCAGAAGAACCTTGGCCTTTAAACGATCTTAATTCCTTCACCGCTATGGATGTAAAGGATGATCCTGTGCAAACAGCTCCAGATACTTCTCCTCGGGCAAGGCACATCACAGATCATTGTTCTATTACTCAAGTCGTTGATCCACCATACCTGTCCCGACCAGCGGCAAAGATTGGTGCTTTCAGACCATATTATCTAGGACACACGGAACCTACCCAACAAGAAATGCCAGGTGCTGTCGTCATGTTTGACTCAACTCATAAAGTCTCGACTCCTGAAAGCGAGGTATTCAAGTTTGTTGATCCTATATGCTTTGCTGCTGAGGTGCCAGACAAATGTGGGTATGGTTGCTGCGGTGCTCATGAGCAGCATCGTAAGAACTCATTGCTGGGTCCTGAGTTCAGTGAGTTTGAAGGTCATCCACCTGTTTTAAATATTAGCTTTGCTTCATTGGTATCAGAAATTAGCAGCATTGCCTGGATGAGAAGTGGTATGCAAAGCAGTGATTCCAGCAACTTGATGCAATCAATTCCACCAACC
TFome clones do not contain stop codon at 3'end.
translation: MSAAETAVSPTTTPQPQLQSDPNAAADAASSNSLWVADETQTLTEVLLQPQPNHLSPPPSGEGDDGITASGAPVGGDAAASASAAAAANATIEERVRGPWSPEEDAVLSNLVEKFGARNWTLIARGIPGRSGKSCRLRWCNQLDPQVKRKPFTEEEDRIIMAAHAVHGNKWASIAKLLDGRTDNAIKNHWNSTLRRRYCNDGQCKHGGSVERSIPKVSREVSEEPWPLNDLNSFTAMDVKDDPVQTAPDTSPRARHITDHCSITQVVDPPYLSRPAAKIGAFRPYYLGHTEPTQQEMPGAVVMFDSTHKVSTPESEVFKFVDPICFAAEVPDKCGYGCCGAHEQHRKNSLLGPEFSEFEGHPPVLNISFASLVSEISSIAWMRSGMQSSDSSNLMQSIPPT