TFome Information for pUT1671

TFome NamepUT1671
Genbank Insert IDHQ858862
Protein NameOsbHLH58
Species Rice
TF Family bHLH
Gene ID LOC_Os03g46860
transcript
VectorpENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: 3' Primer Name: R234DN
5' Primer Tm (º C): 63.0 3' Primer Tm (º C): 60.4
5' Primer Sequence: caccatggaggactcgagcctgttc 3' Primer Sequence: gctttttgtttctcgcgcgctatttct
PCR Condition: Step 1, 98C 30 sec melt, 1 cycle; Step 2, 98C 10 s
Nucleotide Sequence: AuGGAGGACuCGAGCCuGuuCAuGGAGuGGGCCAuGGAGACGCuGCAGCACCuGCACCCGCuGCCGGCGACGCCGCCGCCuGCCGGCGGCGGGuACGCCGGCGACAACGCGACuuuuCCGuCGCuCCAAGCGCuCCGCGAGuCGuCGGuGuCGCAGAACGGCAuGGCCCCGCCGGAGCCAACGGCGCACGAAGGCCACCGAGCCuCCAACAGCuGGAGCuCGGGCGACACGGACAGCGuGuCCGGuGGCGGCGGCGGCGCGGuCAuGGAGCACGACGGAuGGuCGACGuCGCCAAAuuCGGuCAGGuGCGCCGCuGGCGGCGGGGGCGGCGGCGGCGGCGGCGGCCuCuGGCCCGuGAGCuGGAACuuCuCGuCGGCCAuGACGCAGCCGuGCAACGAuCAGGCCACGCCGuCGAACCCGCCGACGACGACGAGAGCGCGCuACGGCGGCGGCGGCGuuCGAuACCuGCCGGCCGCCGuGuCGCCAuCGCCAuCuGCACAGACACGGAGAGCCuCCuCCAAAGGCAACGGCGGCGGuGGCuCCGGCuCCuCGuCGGCGGCGCCGuACGCGCAGGAGCACAuCAuCGCGGAGCGCAAGCGCCGGGAGAAGAuCAACCAGCGGuuCAuCGAGCuCuCCACCGuCAuCCCGGGCCuCAAGAAGAuGGACAAGGCGACGAuCCuCuCCGACGCGGuGAGGuACGuGAAGGAGAuGCAGGAGAAGCuCAGCGAGCuCGAGCAACACCAGAACGGCGGCGuCGAGuCGGCAAuACuCCuCAAGAAGCCGuGCAuAGCCACGuCGuCGuCGGACGGCGGCuGCCCCGCAGCGuCAuCGGCCGuGGCuGGAAGCAGCAGCAGCGGCACGGCGAGAAGCuCGCuGCCGGAGAuCGAGGCGAAGAuCuCGCACGGCAACGuGAuGGuGAGGAuCCACGGCGAGAAuAAuGGCAAGGGGuCGCuGGuGCGGCuGCuCGCCGCGGuuGAAGGGCuCCACCuCGGCAuCACGCACACCAAuGuCAuGCCCuuCuCGGCAuGCACCGCCAuCAuAACCAuCAuGGCAAAGGuGGAGGACGGGGuGAGCGuCACAGCuGAGGACAuuGuAGGGAAGCuAAACACuGuGCuCCAGCAAAACAGCAGAAAuAGCGCGCGAGAAACAAAAAGC
TFome clones do not contain stop codon at 3'end.
translation: MEDSSLFMEWAMETLQHLHPLPATPPPAGGGYAGDNATFPSLQALRESSVSQNGMAPPEPTAHEGHRASNSWSSGDTDSVSGGGGGAVMEHDGWSTSPNSVRCAAGGGGGGGGGGLWPVSWNFSSAMTQPCNDQATPSNPPTTTRARYGGGGVRYLPAAVSPSPSAQTRRASSKGNGGGGSGSSSAAPYAQEHIIAERKRREKINQRFIELSTVIPGLKKMDKATILSDAVRYVKEMQEKLSELEQHQNGGVESAILLKKPCIATSSSDGGCPAASSAVAGSSSSGTARSSLPEIEAKISHGNVMVRIHGENNGKGSLVRLLAAVEGLHLGITHTNVMPFSACTAIITIMAKVEDGVSVTAEDIVGKLNTVLQQNSRNSARETKS