TFome Information for pUT1672

TFome NamepUT1672
Genbank Insert IDHQ858863
Protein NameOsbHLH126
Species Rice
TF Family bHLH
Gene ID LOC_Os09g29830
Request Information: Deposited to ABRC
5' Primer Name: 3' Primer Name: R250DN
5' Primer Tm (º C): 60.2 3' Primer Tm (º C): 58.3
5' Primer Sequence: caccatggacatgagcgagagc 3' Primer Sequence: catttgaaacccatcctgagatggc
PCR Condition: Step 1, 98C 30 sec melt, 1 cycle; Step 2, 98C 10 s
TFome clones do not contain stop codon at 3'end.