TFome Information for pUT1678

TFome NamepUT1678
Genbank Insert IDHQ858869
Protein NameOsbHLH118
Species Rice
TF Family bHLH
Gene ID LOC_Os08g41320
transcript
VectorpENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: 3' Primer Name: R220DN
5' Primer Tm (º C): 67.2 3' Primer Tm (º C): 64.8
5' Primer Sequence: caccatggacggcggcagggtc 3' Primer Sequence: gaactccattttcatgtggcctgcttgctgc
PCR Condition: Step 1, 98C 30 sec melt, 1 cycle; Step 2, 98C 10 s
Nucleotide Sequence: AuGGACGGCGGCAGGGuCGGGGGCGACuACAuuuCCAGCCuCCuCAGCuCCuCCCCCCGGCuCGACuuCGGCGuGCCGGuGCuGGACGCCAuCGuGGCGCCGGGAGGCGGCGGCGGCGGCGGCGACuGCGGCCuCGACAAGCuCuGCGGCGACCCGGuGuuCGCGGAGCGCGCCGCGCGGCuGuCCAGCuuCAACAACGGCGGCGGCGGuGuuGGGCAGCGGuACGGCGGCGCGGGGGCGGGGCuCuuCGGGAuGCCuCCuCCGGCuCCCGGCGACuuCGCCGGAGGuGGCuCCAGGGAGGCGuCCuCCGuGuCCGACCCCGCCuCCuCGGCGAuGAAGGACGCCGCCGCCAAuGCCAAGAAGAGGAAGuCCACGGCGGCGGCGGCCGCCGCCGCCAAGGGCAAAGGCAAGGAGCCuCCGGuuGGGGAAGAGAAGGAAuCAGAuGGCAAGAGGuGCAAGACGGGCAAuGGCGAGAAGGAGAGCuCGGuGAAGCCGAAGGCGGAGCAGGCCGGGAGCGACAGCuCCGuCGAGGACGGCGGCGGuGGCGGGCAGAAGCAAGGGAAGGGGAAGAAuGCCAAGCCGGuGGAGCCACCCAAGGACuAuGuCCAuGuCCGGGCGAGGCGAGGCCAAGCCACuGACAGCCACAGCCuCGCuGAGAGGGuCAGAAGAGAGAGGAuCAGCCAGAGGAuGAAGGuuCuCCAGGACCuGGuuCCAGGAuGCAACAAGGuAAuuGGCAAGGCACuCAuGCuuGAuGAGAuCAuAAACuACGuGCAAuCGCuuCAACGGCAAGuuGAGuuCCuGuCCAuGAAGCuAGCAACuGuGAAuCCACuuGAuuuCAGuAACCuGCCuACuCuGCuGCAGAAAGAuAuGCuCCAAGCAuGCGGCCCuuCAGCGAGCuCGGuuuuCuCAuuAGAAAGCuCCAAuuCuGCuuuuCGGuuuGCCGAACAAGGAGAuGuuuuCCAACAGuuuGCuCAAAACAGCAuGGAAAGCCAGuGCACCCuGAAuCAGuuGGACCuGGCuCuAuCuCAGGCuACAAAuGCuGCACAGuAuGCuuuuCAAGAuGGAACAGCCGGCGCAAACuuGCAGCAAAGGAACuuCuGGGAGGAuGAuCuCCAAAGuGuuuuCCAuAuuGAGAAuGGACAGAGCCAGGAGAAuGGGGuuuCAGCACCAAACuuCCAuGGuCAGCAGCAAGCAGGCCACAuGAAAAuGGAGuuC
TFome clones do not contain stop codon at 3'end.
translation: MDGGRVGGDYISSLLSSSPRLDFGVPVLDAIVAPGGGGGGGDCGLDKLCGDPVFAERAARLSSFNNGGGGVGQRYGGAGAGLFGMPPPAPGDFAGGGSREASSVSDPASSAMKDAAANAKKRKSTAAAAAAAKGKGKEPPVGEEKESDGKRCKTGNGEKESSVKPKAEQAGSDSSVEDGGGGGQKQGKGKNAKPVEPPKDYVHVRARRGQATDSHSLAERVRRERISQRMKVLQDLVPGCNKVIGKALMLDEIINYVQSLQRQVEFLSMKLATVNPLDFSNLPTLLQKDMLQACGPSASSVFSLESSNSAFRFAEQGDVFQQFAQNSMESQCTLNQLDLALSQATNAAQYAFQDGTAGANLQQRNFWEDDLQSVFHIENGQSQENGVSAPNFHGQQQAGHMKMEF