TFome Information for pUT1749

TFome Name pUT1749
Template EC905796
Genbank Insert ID HQ858768
Protein Name ZmMYB40
Species Maize
TF Family MYB
Gene ID GRMZM2G051256
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: C21 UP 3' Primer Name: C21 DN
5' Primer Tm (º C): 65.0 3' Primer Tm (º C):
5' Primer Sequence: CAC CAT GGG GAG GGC GCC 3' Primer Sequence: GAGATTGTCCAGGAAGAAgag
PCR Condition: Step 1, 98C 30 sec melt, 1 cycle; Step 2, 98C 10 s
Nucleotide Sequence: ATGGGGAGGGCGCCGTGCTGCGAGAAGGTGGGGCTGAAGAAGGGGAGGTGGACCAAGGAGGAGGACGAGGTCCTGGCGAGGTACATCAAGGAGCACGGGGAAGGATCGTGGAGGTCACTGCCCAAGAATGCCGGGCTGCTGCGGTGCGGGAAGAGCTGCAGGCTGCGGTGGATCAACTACCTGCGGGCGGGTCTCAAGAGGGGGAACATCTCGGAGGAGGAGGAGGACATGATCATCAAGCTCCACGCCACGCTTGGCAACAGGTGGTCCCTGATCGCCGGTCACTTGCCCGGTCGAACAGACAACGAGATCAAAAACTACTGGAACTCGCACCTGAGCAGGCGGGCGGCCGACTTCCGCGACGGCGTCGTCGTCGACATCGACCTCAGCAAGCTGCCCGGCGGCGGGAAACGGCGCGGCGGCCGGGCCAGCCGGGGCGCCGTCGTGGCCGCGGCCAAGGAGAAGAAGGCCAAGGAGAAGGACGACAGGGGCAATAGCAAGGTCGCAGAAGCGGAGCAGCAGCTCAGGGACACGGAGGACGACGACGGCGGCAGCGTCTCCACGCCGAGGCCTCAGTCTGATGACTGCGGCACCGCCCAGAGCGAAGAGGAGCAAGCGCAGGCCAGCGCCAGCGGCCTGACATCCGATGGGCATGGGCCCGAGGAGGAGGAGGAGGAGGACCCGCTGGCTCTGAGCGAGGAGATGGTGAGTGCGCTTCTGGCCCCGGAAAGCCCAAAGCTGGAGGTGGGCCCCGATGGCTCGTGCATGGACAGCTACAGTGGCCCTCCGTCAGGGGAAAGCGGCTGTGGGTCCAGTGGGCCTTCTGGCGACGTGGCCCAGGACCTGGACCTAGACGACGACAAGGCCATCATGGACTGGGACTTGATGGGGCTGGACATCTCGACCGCCGGTGACATGTGGGACCAGCTGGTGTGGGACTACGACGAAACGTTGGTCACGGAACCGGAAGGAGGGGAGGAAGGGCACCAGCAGCAGGACGATGTCATGTCAGACCTCTTCTTCCTGGACAATCTC
TFome clones do not contain stop codon at 3'end.
translation: MGRAPCCEKVGLKKGRWTKEEDEVLARYIKEHGEGSWRSLPKNAGLLRCGKSCRLRWINYLRAGLKRGNISEEEEDMIIKLHATLGNRWSLIAGHLPGRTDNEIKNYWNSHLSRRAADFRDGVVVDIDLSKLPGGGKRRGGRASRGAVVAAAKEKKAKEKDDRGNSKVAEAEQQLRDTEDDDGGSVSTPRPQSDDCGTAQSEEEQAQASASGLTSDGHGPEEEEEEDPLALSEEMVSALLAPESPKLEVGPDGSCMDSYSGPPSGESGCGSSGPSGDVAQDLDLDDDKAIMDWDLMGLDISTAGDMWDQLVWDYDETLVTEPEGGEEGHQQQDDVMSDLFFLDNL