TFome Information for pUT1750

TFome Name pUT1750
Genbank Insert ID HQ858873
Protein Name OsWRKY12
Species Rice
TF Family WRKY
Gene ID LOC_Os01g51690
Request Information: Deposited to ABRC
5' Primer Name: 3' Primer Name: R239DN
5' Primer Tm (º C): 65.6 3' Primer Tm (º C): 65.0
5' Primer Sequence: caccatgtacatggcggcggcg 3' Primer Sequence: attaaggtctgggtgactgatcccggcg
PCR Condition: Step 1, 98C 30 sec melt, 1 cycle; Step 2, 98C 10 s
TFome clones do not contain stop codon at 3'end.