TFome Information for pUT3150

TFome Name pUT3150
Genbank Insert ID JX469907
Protein Name ZmMYB133
Species Maize
TF Family MYB
Gene ID GRMZM2G149958
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: B287_F 3' Primer Name: B287_R
5' Primer Tm (º C): 65.5 3' Primer Tm (º C):
5' Primer Sequence: caccATGGCCGTGGACGAGGC 3' Primer Sequence: CCCATGAGATGGTGGGGG
PCR Condition: 40 sec 98°C, 30x(15sec 98°C, 30sec 45°
Nucleotide Sequence: ATGGCCGTGGACGAGGCGAGCAGCAGTGGCGGTGGGGAGGAGGGGTGCGGGTCGTGGACCCGCGAGCAGGAGAAGGCGTTCGAGAACGCGGTGGCGACGATGGGCGGGGAGGAGGACGGGGACGCGAGGTGGGAGAAGCTAGCGGAGGCCGTCGAGGGGAAGACGCCGGAGGAGGTCAGGCGGCACTACGAGCTGCTGGTGGAGGACGTCGACGGCATCGAGTCGGGCCGCGTCCCGCTTCCGGCGTACGCGGCTGACGGCGCTGCCGAGGAAGGGGGCGGTGGCGGGAAGAAGGGAAGTGGCGGAGGAGGGACCCATGGGGACAAGGGGTCGGCGAAGTCCGCCGAGCAGGAGCGTAGGAAGGGCATCGCCTGGACAGAGGACGAGCACAGATTGTTCCTCCTTGGACTTGAAAAGTATGGCAAAGGTGACTGGCGGAGCATCTCGCGGAACTTTGTGATCTCAAGGACGCCGACTCAAGTAGCTAGTCATGCACAGAAGTACTTTATCCGTCTGAACTCAATGAACAGAGAAAGGCGGCGATCAAGTATACATGACATCACCAGTGTGAACAATGGAGATCCATCAACTGCACAGGGTCCAATCACAGGCCAAACAAATGGTCAGGCTGCAAATCCTGGAAAACCATCTAAGCAATCCCCGCAGCCAGCGAATACACCTCCAGGCGTCGATGCTTATGGCACAACAATTGGACAGCCAGTTGGTGGCCCCCTTGTCTCAGCTGTTGGAACTCCCGTTACACTACCTGTTTCCGCTCCACCTCATCTGGCCTATGGCATGCGTGCCCCGGTTCCAGGAGCCGTAGTACCTGGTGCTCCAGTAAACATTGCTCCGATGCCCTATCCAATGCCACCCCCACCATCTCATGGG
TFome clones do not contain stop codon at 3'end.
translation: MAVDEASSSGGGEEGCGSWTREQEKAFENAVATMGGEEDGDARWEKLAEAVEGKTPEEVRRHYELLVEDVDGIESGRVPLPAYAADGAAEEGGGGGKKGSGGGGTHGDKGSAKSAEQERRKGIAWTEDEHRLFLLGLEKYGKGDWRSISRNFVISRTPTQVASHAQKYFIRLNSMNRERRRSSIHDITSVNNGDPSTAQGPITGQTNGQAANPGKPSKQSPQPANTPPGVDAYGTTIGQPVGGPLVSAVGTPVTLPVSAPPHLAYGMRAPVPGAVVPGAPVNIAPMPYPMPPPPSHG