TFome Information for pUT5354

TFome Name pUT5354
Genbank Insert ID KJ727495
Protein Name ZmMYB139
Species Maize
TF Family MYB
Gene ID GRMZM2G087955
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: B288_F 3' Primer Name: B288_R
5' Primer Tm (º C): 70.6 3' Primer Tm (º C):
5' Primer Sequence: caccATGGCGGCGTCGCCTTCCCC 3' Primer Sequence: GTCGATCTCGGCCATGCCCATCAC
PCR Condition: 40 sec 98°C, 30x(15sec 98°C, 30sec 58°
Nucleotide Sequence: ATGGCGGCGTCGCCTTCCCCGTCCGGCAGCGGCGGCGGCAAGGCCGGCGTGGACCGGATCAAGGGCCCCTGGAGCCCCGAGGAGGACGAGGCCCTGCAGCGCCTCGTGCGCCGCCACGGCGCGCGCAACTGGTCCCTCATCAGCCGCTCCGTCCCGGGCCGGTCCGGCAAGTCGTGCCGCCTCCGGTGGTGCAACCAGCTGTCGCCGCGGGTGGAGCACCGCCCCTTCACGCCCGACGAGGACGACGCCATCCTCCGCGCGCACGCCAGGTTCGGCAACAAGTGGGCCACCATCGCGCGCCTCCTCTCCGGACGCACGGACAACGCCATCAAGAACCACTGGAACTCCACGCTCAAGCGCGAGCGCGAGCGCAAGCGCGAGTACTACGCCGATGCGCGCCCCGGCCCCGGCGACCAGCGCTCGCTCAAGCGCACCAGCAGCGACGGGCCCCCCGGAAGCCCGTCCGGGTCCGACCTCAGCGACTCCAGCCACCAGAGCCTTCCCACCGTGATGCCGTCAGCCGCTTCTACCGCCGTCACCTCCCAGCAGCAGCTACAACACGTGTACTACCGCCCCGTGCCGCGCGCGGGCGGCGTGGTCCTGCTCCCGGTGGCGCCGCCTTCTCCGCAGGCTCCTCCAGCAACCTCCTTGTCGTTGTCCCTCTCCCTGCCAGGGCTGGACCAGCAGCCCGAACCATCCCCGCCGCCGCCGCCAACACCTCAAGCACAAGCAAGCTCGCCGTTGAGCGCGGAGTTCCTGTTGATGATGCAGGAGATGATCCGGATCGAGGTCCGGAACTACATGTCCGGGTCGGGCTTCGACGCACACGCCGTGATGGGCATGGCCGAGATCGAC
TFome clones do not contain stop codon at 3'end.
translation: MAASPSPSGSGGGKAGVDRIKGPWSPEEDEALQRLVRRHGARNWSLISRSVPGRSGKSCRLRWCNQLSPRVEHRPFTPDEDDAILRAHARFGNKWATIARLLSGRTDNAIKNHWNSTLKRERERKREYYADARPGPGDQRSLKRTSSDGPPGSPSGSDLSDSSHQSLPTVMPSAASTAVTSQQQLQHVYYRPVPRAGGVVLLPVAPPSPQAPPATSLSLSLSLPGLDQQPEPSPPPPPTPQAQASSPLSAEFLLMMQEMIRIEVRNYMSGSGFDAHAVMGMAEID