TFome Information for pUT5381

TFome Name pUT5381
Template Genomic DNA
Genbank Insert ID KJ727522
Protein Name ZmMYB107
Species Maize
TF Family MYB
Gene ID GRMZM2G172575
transcript T01
Vector pENTR/SD/D-TOPO
Note c.C808T p.P270S Not present in functional domain.
Request Information: Deposited to ABRC
5' Primer Name: SE0068_F 3' Primer Name: SE0068_R
5' Primer Tm (º C): 59.0 3' Primer Tm (º C):
5' Primer Sequence: caccATGCATGTCAGCATGTGTATATATAACC 3' Primer Sequence: GCTAAAACAGCATGGACAGTGAGCAG
PCR Condition: Step 1, 98°C 3 min melt, 1 cycle; Step 2, 98&d
Nucleotide Sequence: ATGCATGTCAGCATGTGTATATATAACCGTCGTCACACACACGCTAGCTTCAAGGAACAGGGGGGACGATCAGATCGGAGGAGGAAGATGGAGAGCAGGCCGCCAATGCCATGGTGCGCGTGCGACAGGGCGGGGACGACGACGACGATGACGACGGCGATAAAGAAGGGGCCATGGATGCCGGAGGAGGACCTCGTCCTCGTCTCCTACATCCACGAGCACGGCCCCAGCAAGTGGCGCCACGTGGCCGCGAGCACGGGGCTCATGCGCTGCAGCAAGAGCTGCCGCCTCCGCTGGACCAACTACCTCCGCCCGGGCATCCGGCGCGGCCACTTCACGGCGCGCGAGGAGCGCGTCATCGTCCACCTCCACTCCCTGCTGGGCAACCGGTGGGCGGCCATCGCGTCGCATCTCCCCCAGCGCACCGACAACGACATCAAGAACTACTGGAACACCCACCTCAAGAAGAAGAAGGTCGTCGTCGAGGAACAGCAGCGAGCGGCTGCAGCAGCAGCCAAACGACACGTCGACGACGGCGGCATCACCACCAGTCGTAGTCCCCGCCTGCTCGCCAAGGACGATAGCTATGGCTACGACTACGACGCGCGCCCAGCTGCAGCCTATCCCTGTACCATGGACAACGTATCCAAGCCTCTCAAAGTCAAATTAGGTTGCATGAAGAGCGCATCGTCATCATCCCCGCCGGCGCAGGATGGTAGTAGTAGTATCCGTCGTCCTTTCTTTTCACTCGACCAAACGTCCGGCAGTACGGCGCCGCTGCCACCCATCTCCAACGTTGTGCCGCAGTCGGTGTTGGCGGGACAGGGACGACACGGCGGGCGTTTCTTCCACGAGCCGCCCCAGCAGCAGCTGTCCTCAATAATGGAGAACTGGTTATTCCTCCCCAAGCAGCAGCACCAGCAGCAGATGACGGCGAGCTCTCCGACTCCGACGGCTGCTGCTCACTGTCCATGCTGTTTTAGC
TFome clones do not contain stop codon at 3'end.
translation: MHVSMCIYNRRHTHASFKEQGGRSDRRRKMESRPPMPWCACDRAGTTTTMTTAIKKGPWMPEEDLVLVSYIHEHGPSKWRHVAASTGLMRCSKSCRLRWTNYLRPGIRRGHFTAREERVIVHLHSLLGNRWAAIASHLPQRTDNDIKNYWNTHLKKKKVVVEEQQRAAAAAAKRHVDDGGITTSRSPRLLAKDDSYGYDYDARPAAAYPCTMDNVSKPLKVKLGCMKSASSSSPPAQDGSSSIRRPFFSLDQTSGSTAPLPPISNVVPQSVLAGQGRHGGRFFHEPPQQQLSSIMENWLFLPKQQHQQQMTASSPTPTAAAHCPCCFS