TFome Information for pUT5428

TFome NamepUT5428
Genbank Insert IDKJ727568
Protein NameZmWRKY102
Species Maize
TF Family WRKY
Gene ID GRMZM2G070211
transcript T01
VectorpENTR/SD/D-TOPO
Notec.A405G p. (=) Not present in template FLcDNA.
Request Information: Deposited to ABRC
5' Primer Name: B741_F 3' Primer Name: B741_R
5' Primer Tm (º C): 63.2 3' Primer Tm (º C):
5' Primer Sequence: caccATGGAGGAAGTGGAGGAAGCG 3' Primer Sequence: CACCTGTGCTGACTGAGTTGTTGGC
PCR Condition: 40 sec 98°C 30x : 15 sec 98°C 30 sec 58&de
Nucleotide Sequence: ATGGAGGAAGTGGAGGAAGCGAACAGGGAAGCCGTGGAGAGCTGCCACAGGGTGCTCGCCTTGCTCTCCCAGCCGCATGACCCCGCGCAGGCCAGGAGCATAGCTCTGGGCACGGACGAAGCATGTGCCAGGTTCAGGAAGGTGGTCTCTCTACTGAGCAATGGAGGAGCGGGGCTAGGAGAAGCCGGGCCGTCATGCGGAAGCGCAAGCGCAAGCCGTCCTAGAGCTAAGCTTGTTAGCAGAAGACAGAATCCAGGGTTCTTGACCCAGAAAGGCTTCCTGGACAGCAACACCCCGGTCGTGGTGTTGAACAGCGCCCATCCTTCTACTACCTCCGCGCAGGTGTACCCTAGAACTGGAGCTCTCGTCGATGCACAGAGCGTGCACCCCCTCGGAGTCGGAGGGCCTCCCAAGCTGGTCCAGCCCTTGTCCGCGCACTTTCAGTTCGGCAGTGTGCCGGCTCGGTATCAGTTCCCGAATCAGCAGCAGCAGAAGTTGCACGCCGAGATGTTCAAGAGAAGCAACAGCGGGGTTAACCTGAAGTTCGAGAGCGCCAGTGGCACTGCTGGGACGATGTCGTCGGCGAGGTCCTTCTTGTCGTCTCTGAGCATGGACGGTAGCGTGGCTAGCCTGGACGCCAAGTCATCGTCGTTCCATTTGATCGGTGGACCTGCGATGAGCGATCCGCTGAACGCGCAGCAGCCCCCGAGGAGGCGGTGCACGGGCCGTGGGGAGGATGGGACCGGCAAGTGCGCTGTTACAGGGAGGTGCCACTGTTCGAAGAGAAGTAGGAAGTTGCGGGTGAAGAGGTCGATTAAGGTTCCTGCCATTAGTAACAAGATTGCCGATATACCTCCGGATGAATACTCGTGGAGGAAGTATGGGCAGAAGCCAATTAAGGGTTCCCCTCATCCTAGGGGTTACTACAAATGCAGTAGCGTGAGGGGCTGCCCAGCCAGGAAGCATGTGGAACGGTGCGTAGATGATTCGGCGATGCTCATCGTGACATATGAGGGCGAGCACAACCACACCAGAATGCCAACAACTCAGTCAGCACAGGTG
TFome clones do not contain stop codon at 3'end.
translation: MEEVEEANREAVESCHRVLALLSQPHDPAQARSIALGTDEACARFRKVVSLLSNGGAGLGEAGPSCGSASASRPRAKLVSRRQNPGFLTQKGFLDSNTPVVVLNSAHPSTTSAQVYPRTGALVDAQSVHPLGVGGPPKLVQPLSAHFQFGSVPARYQFPNQQQQKLHAEMFKRSNSGVNLKFESASGTAGTMSSARSFLSSLSMDGSVASLDAKSSSFHLIGGPAMSDPLNAQQPPRRRCTGRGEDGTGKCAVTGRCHCSKRSRKLRVKRSIKVPAISNKIADIPPDEYSWRKYGQKPIKGSPHPRGYYKCSSVRGCPARKHVERCVDDSAMLIVTYEGEHNHTRMPTTQSAQV