TFome Information for pUT5430

TFome NamepUT5430
Genbank Insert IDKJ727570
Protein NameZmWRKY111
Species Maize
TF Family WRKY
Gene ID GRMZM2G013391
transcript T01
VectorpENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: B749_F 3' Primer Name: B749_R
5' Primer Tm (º C): 63.9 3' Primer Tm (º C):
5' Primer Sequence: caccATGTCGTCGGGCGAGGA 3' Primer Sequence: GGAGCACGGCGCGGTAGC
PCR Condition: 40 sec 98°C 30x : 15 sec 98°C 30 sec 58&de
Nucleotide Sequence: ATGTCGTCGGGCGAGGACGGGTACTGCAGCTCGGATTCGCCGCGGGCGGAATCCCCCGACCAGCCGCAGGCAGCTGCGGCGGCGGACGCGGACGCGGACGCGGAGTCGCCTCGCGCCGGAGCCGGGCCGAACAAGCGCGACCTCCACGCCTCGTCGCCGGCAGCTAAGCGCAGCCGGAGATCGGTGGAGAAGCGGGTTGTGTCGGTGCCGCTGGCCGAGTGCGGGGAGGGGCCGCCGCCGTCTGACTCGTGGGCGTGGCGCAAGTATGGGCAGAAGCCCATCAAGGGCTCCCCCTACCCACGTGGGTACTACCGCTGCAGCAGCTCCAAGGGGTGCCCCGCGAGGAAGCAGGTGGAGCGCAGCCGCGCCGACCCTGCCGTGCTGCTCGTCACCTACACCTTCGACCACAACCACGAGGCGCCGCGGCCCAAGAGCAGCTGCTGCCACCAGCAAGGCAGGCCGCCGGCGCCGAAGCCTGATGAGCCCGTGGCCGAGCAGGAGGATGAGCTGGGTCCGGAGCATGAGCCGGAAGACGAGCAGGAGCCGGAGCAGAAGGTCGTCCCAGGTCTGGCCGGGCCGGAAACGGCGCCGGCAACCGCAACGTTGGCGCCGGTGGCAGAGGAGGACGAAAGCTTCGACTTGGGGTGGTTCGACCAGTACCCGACGTGGCACCGTTCGGCGCTGTACGCGCCGCTGCTGCCGCCGGAGGAGTGGGAGCGGGAGCTGCAGGGGGAAGACGCCCTGTTCGCGGGCCTCGGCGAGCTGCCCGAGTGCGCCGTCGTGTTCGGCCGCCGCCGCGAGCTCAGCCTGGCCGCTACCGCGCCGTGCTCC
TFome clones do not contain stop codon at 3'end.
translation: MSSGEDGYCSSDSPRAESPDQPQAAAAADADADAESPRAGAGPNKRDLHASSPAAKRSRRSVEKRVVSVPLAECGEGPPPSDSWAWRKYGQKPIKGSPYPRGYYRCSSSKGCPARKQVERSRADPAVLLVTYTFDHNHEAPRPKSSCCHQQGRPPAPKPDEPVAEQEDELGPEHEPEDEQEPEQKVVPGLAGPETAPATATLAPVAEEDESFDLGWFDQYPTWHRSALYAPLLPPEEWERELQGEDALFAGLGELPECAVVFGRRRELSLAATAPCS