TFome Information for pUT5434

TFome Name pUT5434
Genbank Insert ID KJ727574
Protein Name ZmWRKY29
Species Maize
TF Family WRKY
Gene ID GRMZM2G040298
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: B770_F 3' Primer Name: B770_R
5' Primer Tm (º C): 64.7 3' Primer Tm (º C):
5' Primer Sequence: caccATGGACGCCGAGTGGAGC 3' Primer Sequence: CTTCACCCGGCCTGCCAC
PCR Condition: 40 sec 98°C 30x : 15 sec 98°C 30 sec 58&de
Nucleotide Sequence: ATGGACGCCGAGTGGAGCGGCGACGAGAGCAAGGCTGGCGCTGCGGGCGGAGTTTCGTCGGCTGATTGCCCAAGTTCGCCACCGCCGGTGTCGCCGGCGCCACCGTCCACGTCGCCAGCTGCTACCGGTGCCGGGAGGAGGCGGTCGGCGAACAAGCGGGTGGTCACCGTGCCGCTGGCGGACGTCAGTGGCCCACGGCCCAAGGGCGTCGGCGAGGGCAACACGCCGACGGACGCGTGGGCGTGGCGCAAGTACGGCCAGAAGCCCATCAAGGGCTCGCCTTTTCCGAGGGCTTACTACAGGTGCAGCAGCTCCAAGGGGTGCCCGGCCAGGAAGCAGGTGGAGCGGAGCAGGGCGGAGCCGGACAAGGTGATCGTCACGTACTCGTTCGAGCACAGCCACTCGGAGGCCATGGCGGCGGCGAGGGCGCAGAACCGCCAGGCCCCGAAGCCAAAGCCGGCCCAGCCACAGCCAGTCCCGCCGGAGTCCCCGTCATCCGGCAGCCACGACGTCGCTGCCGCTGCCACGGTCGTCTGCGCGCCTGCTGCGGCCGAGACCGAGGCCGGCGCGGCGGCCGTCGAGGTGCACGACGAGTTCAGGTGGCTCTACGACGGCGTGTCCGTCACCTCCTCGGCGTCCCCACCGGACGTCGAGGCGGCGGACGAGATGCTGTACGGGGCGATGTTCTTCGGCGCCCCGCCCGCGCCCCTCCCCGACGAGTTCGGCGACGTCGGCGGGCTGTTCGACGGAGAAGGGGGCGAGGAGGACGCCATGTTCGCGGGTCTCGGCGAGCTGCCCGAGTGCGCCATGGTGTTCCGGCGGCACGCCGGCGACGGGATTTCGGTGGCAGGCCGGGTGAAG
TFome clones do not contain stop codon at 3'end.
translation: MDAEWSGDESKAGAAGGVSSADCPSSPPPVSPAPPSTSPAATGAGRRRSANKRVVTVPLADVSGPRPKGVGEGNTPTDAWAWRKYGQKPIKGSPFPRAYYRCSSSKGCPARKQVERSRAEPDKVIVTYSFEHSHSEAMAAARAQNRQAPKPKPAQPQPVPPESPSSGSHDVAAAATVVCAPAAAETEAGAAAVEVHDEFRWLYDGVSVTSSASPPDVEAADEMLYGAMFFGAPPAPLPDEFGDVGGLFDGEGGEEDAMFAGLGELPECAMVFRRHAGDGISVAGRVK