TFome Information for pUT5435

TFome Name pUT5435
Genbank Insert ID KJ727575
Protein Name ZmHB115
Species Maize
TF Family Homeobox
Gene ID GRMZM2G021339
transcript T01
Vector pENTR/SD/D-TOPO
Note c.A605G p.E202G SNP present in template FlcDNA, not in functional domain.
Request Information: Deposited to ABRC
5' Primer Name: B773_F 3' Primer Name: B773_R
5' Primer Tm (º C): 64.1 3' Primer Tm (º C):
5' Primer Sequence: caccATGGAGTCCGGACGGCTC 3' Primer Sequence: GTTCCACATCCACCACCAGCTG
PCR Condition: 40 sec 98°C 30x : 15 sec 98°C 30 sec 60&de
Nucleotide Sequence: ATGGAGTCCGGACGGCTCATCTTCAACGCGCCCGGCTCCGGCGCCGGGCAGATGCTCTTCCTGGACTGCGGCGCAGGCGGTGGTCCCGGCGGCGGCTTGTTGCATCGAGGCGGGAGACCGATGCTTGGCCTTGAAGAAGGGCGCGGCGTAAAACGGCCCTTCTACACCTCGCCCGACGAGCTCCTCGAGGAGGAGTACTACGACGAGCAGCTGCCGGAGAAGAAGCGCCGCCTGACGCCGGAGCAGGTGCACCTGCTGGAGAGGAGCTTCGAGGAGGAGAACAAGCTGGAGCCGGAGCGCAAGACGGAGCTGGCGCGCAAGCTGGGCCTGCAGCCCCGGCAGGTGGCCGTGTGGTTCCAGAACCGGCGCGCCCGGTGGAAGACCAAGCAGCTGGAGCGCGACTTCGACCGCCTCAAGGCCTCCTTCGACGCCCTCCGCGCGGACCACGACGCCCTTCTCCAGGACAACCACCGCCTCCGCTCACAGGTGGTGTCGTTGACCGAGAAGCTGCGAGAGAAGGAGGCGACGGAGGGCGACGCCAACGGCGCCGCGGCGGCGTTGCCGGCGGTGGGCGTTGTCAGGGCTTCCGTGGCCGATGACGTCGGGGAACCGGAGCCGGAGCCGGAGCCGGAGGCAGAGGCGGCGGCGTTCGAGGAGCGGCAGGTGAAGTCCGAGGACAGGCTGAGCACGGGCAGCGGCGGGAGCGCGGTGGTGGACGCGGCGGACGCGCTGTTGTACAACGGCAGGATCGGCGGCGCGGCCGTCGATAGCAGCGTCGAGTCGTACTTCCCCGGCGCCGAGGTCCAGGACCAGTACCACGGCTGCGGGACGATGGGTCCAGTAACCCACGGCGCTGGAGGCATCCAGTCGGACGACGACGACGGCGCCGGCAGCGACGAGGGATGCAGCTACTACGCCGACGAAGAAGCCGCCGCCGCGTTCCTCTCCGAACACACCCACCACGCGGACGGCGACGACGAGGACGCCGGCCAGGTCAGCTGGTGGTGGATGTGGAAC
TFome clones do not contain stop codon at 3'end.
translation: MESGRLIFNAPGSGAGQMLFLDCGAGGGPGGGLLHRGGRPMLGLEEGRGVKRPFYTSPDELLEEEYYDEQLPEKKRRLTPEQVHLLERSFEEENKLEPERKTELARKLGLQPRQVAVWFQNRRARWKTKQLERDFDRLKASFDALRADHDALLQDNHRLRSQVVSLTEKLREKEATEGDANGAAAALPAVGVVRASVADDVGEPEPEPEPEAEAAAFEERQVKSEDRLSTGSGGSAVVDAADALLYNGRIGGAAVDSSVESYFPGAEVQDQYHGCGTMGPVTHGAGGIQSDDDDGAGSDEGCSYYADEEAAAAFLSEHTHHADGDDEDAGQVSWWWMWN