TFome Information for pUT5470

TFome NamepUT5470
Genbank Insert IDKJ727610
Protein NameZmHB112
Species Maize
TF Family Homeobox
Gene ID GRMZM2G003304
transcript T01
VectorpENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: C426_F 3' Primer Name: C426_R
5' Primer Tm (º C): 65.2 3' Primer Tm (º C):
5' Primer Sequence: caccATGCATCCGAGCGCGGT 3' Primer Sequence: GTTCCAGAACCAAGATGTCCAGTTGGC
PCR Condition: 40 sec 98°C 30x : 15 sec 98°C 30 sec 58&de
Nucleotide Sequence: ATGCATCCGAGCGCGGTCAGTTTCGACTCCGGCGACGGGCGGCGGCGCGGTGGCGCGCAGATGCTGCTCTTCGGCGGCGGAGGCAGCGCCAACAGCAACGGCTTCTTCCGAGGTGTTCCGATGGCGGTCCTGGCCATGGACGACGCGACGCGCGTGGGCAAGCGGCCCTTCTTCACGACACACGAGGAGCTCCTGGAGGAGGAGTACTACGACGAGCAGGCGCCGGAGAAGAAGCGCCGTCTGACGGCGGAGCAGGTGCAGCTGCTGGAGCGGAGCTTCGAGGAAGAGAACAAGCTGGAGCCTGAGCGCAAGACCGAGCTGGCTCGCCGCCTGGGGATGGCGCCCCGCCAGGTGGCCGTGTGGTTCCAGAACCGCCGCGCGCGTTGGAAGACAAAGCAGCTCGAGACCGACTATGACCGCCTCAAGGCTGCCTACAACGCGCTCGCCGCTGACCACCAGGGCCTCCTGGCCGACAACGATAGCCTCCGGGCACAGGTGATCTGCCTAACAGAGAAGCTGCAAGGCAAGGAGACATCCCTGTCGGCAACCATCGCTGCCCAAGAGGTCGACCAGCCAAACGAACACACCACAGGCACTGAGAAATTGCTGGCGCAGCAGCTCAAGGACGACCTGCACAGCAGCTGCGGTTGCACTGGACATGGTGCCCTGTCTTCGGAGGAAGAGGATGGTGGCGTGGTCAGCGATGAGGGCTGCAACTTTGATCTCCCCGACGCCATGTTTGCTGTTGGGGTCACCAACCATGGTGCTGAGGAGGCGCAGCTGGCCAACTGGACATCTTGGTTCTGGAAC
TFome clones do not contain stop codon at 3'end.
translation: MHPSAVSFDSGDGRRRGGAQMLLFGGGGSANSNGFFRGVPMAVLAMDDATRVGKRPFFTTHEELLEEEYYDEQAPEKKRRLTAEQVQLLERSFEEENKLEPERKTELARRLGMAPRQVAVWFQNRRARWKTKQLETDYDRLKAAYNALAADHQGLLADNDSLRAQVICLTEKLQGKETSLSATIAAQEVDQPNEHTTGTEKLLAQQLKDDLHSSCGCTGHGALSSEEEDGGVVSDEGCNFDLPDAMFAVGVTNHGAEEAQLANWTSWFWN