TFome Information for pUT5518

TFome Name pUT5518
Genbank Insert ID KJ727611
Protein Name ZmMYB61
Species Maize
TF Family MYB
Gene ID GRMZM2G108959
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: B285_F 3' Primer Name: B285_R
5' Primer Tm (º C): 73.4 3' Primer Tm (º C):
5' Primer Sequence: caccATGGGGAGGCCACCGTGCT 3' Primer Sequence: GAACATGATGGGATCCGCA
PCR Condition: PCR Reaction Mix: 5 l GC buffer (NEB) 1 l primer f
Nucleotide Sequence: ATGGGGAGGCCACCGTGCTGCGACAACGGCGTCGGCGTCAAGAAAGGGCCGTGGACGCCCGAGGAGGACATCGTCCTCGTCTCCTACATCCAGCAGCACGGCCCCGGGAACTGGCGGTCCGTGCCAGAGAACACAGGGTTGATGAGGTGCAGCAAGAGCTGCAGGCTGCGGTGGACCAACTACCTGAGGCCTGGGATCAAGCGTGGAAACTTCACTCCTCATGAGGAAGGGATCATCATCCACCTCCAGGCGTTGCTTGGCAACAAGTGGGCAGCCATAGCCTCCTACCTCCCTCAAAGGACTGACAACGACATCAAGAACTACTGGAACACACACCTCAAGAAGAAGGTGAAGAGGCTGCAACAGCCGGCAGCCGACTCCTTCCAGACAACTGCCTCCAATGCAGTCACCTGCAGCCCAAACTACTACAGCCCCAGCAGCAGTCACCACAGCCTCCAAGGAATGCAGCCGATGAGCAGCTACCCCCACACCACCTGCAGCGGCGGAGCCCCAAGCAACAATGAGGCGATGACTGATACTACTACCGGCGTCGTCTCCAACCTCTTCCAGGCATGGATGAGGCCATCACCAGCAGCAGCGACAGCTAACTGCAAAATCGCCATGCAGGAGTTCCAGGAAGAACAAGGCGCTGCAGCAGCAGCCTCAATAGTCTGCAAGGAACAGATGGTGACCTGCGGTGATGTTAACAGGCCGCCGGCGCTGGAGATGGTGGTGGCGCCGGTGATGGGTGCGAGCACTGCCACCTTCTCGCTGCTCGAGGACTGGCTGCTCGATGACATGCCGGGGCAGGCCATGGATGGGTTCATGGGGATCTCCGCCGGTTGCTGTGCGGATCCCATCATGTTC
TFome clones do not contain stop codon at 3'end.
translation: MGRPPCCDNGVGVKKGPWTPEEDIVLVSYIQQHGPGNWRSVPENTGLMRCSKSCRLRWTNYLRPGIKRGNFTPHEEGIIIHLQALLGNKWAAIASYLPQRTDNDIKNYWNTHLKKKVKRLQQPAADSFQTTASNAVTCSPNYYSPSSSHHSLQGMQPMSSYPHTTCSGGAPSNNEAMTDTTTGVVSNLFQAWMRPSPAAATANCKIAMQEFQEEQGAAAAASIVCKEQMVTCGDVNRPPALEMVVAPVMGASTATFSLLEDWLLDDMPGQAMDGFMGISAGCCADPIMF