TFome Information for pUT5586

TFome Name pUT5586
Template Genomic DNA
Genbank Insert ID KJ727659
Protein Name ZmMYB119
Species Maize
TF Family MYB
Gene ID AC213884.3_FG002
transcript T002
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: SE0005_F 3' Primer Name: SE0005_R
5' Primer Tm (º C): 62.3 3' Primer Tm (º C):
5' Primer Sequence: caccATGGTGGTATCGTCGAGTGGT 3' Primer Sequence: CGGGTCCACGTCCATCGAC
PCR Condition: Step 1, 98°C 3 min melt, 1 cycle; Step 2, 98&d
Nucleotide Sequence: ATGGTGGTATCGTCGAGTGGTGGCGCGGGAGGCGTGGAGGGTGGCAGCGGCTGCGGTGTCTCGGCGTCGGTGCCGCCGGTGGTGTCGTCGAGCGGTGGCGCGGGAGAGGTGGAGGGTGGCGACGGCGGCTCGGCGGCGGTGTCGGGGTGCCGCCGGAGGGTGAAGGGGTCGTGGACGCCGGAGGAGGACGAGCTGCTGCGGCGCGCGATCACGCGGCACGGGCCGCGGAACTGGACCGTGATCAGCTCCGAGATCCCCGGCCGGTCCGGCAAGTCGTGCCGCCTGCGGTGGTGCAACCAGCTCAGCCCCAGCGTGGAGCGCCGCGCCTTCACGCCCGAGGAGGACGCCATCATCGTCGCCGCGCACGCGCAGCACGGCAACAGGTGGGCCACCATCGCGCGGATGCTCCACGGCCGCACCGACAACTCCGTCAAGAACCACTGGAACTCCACGCTGCTCCGCCAGCGCAGGGCGGCGGCCGCCCATGCCAGCGCCGCCGGGTGCGCCCTCCAGCTGCGGCCGGCGACCACGGCCTCCGTCCCGCTCCGCCATCTGCTGGATCGTCCTAAGGAGGCGGCGGCATCCGTTTCGTTCCGTCGTCTGGACCCAAAGGCGGAGGAGGAGGAGGACGAGGACATGGACGAAGGCGGCAGCAGCAGCGAGGATTCGGCGCATCGGCATCGTTCGCTGTCACCCGCGCCGGTCGAGCCGCTCACACTCAATCTATTTAGCGACGGAGCCCACGGGCTCCCTACCCCCGCCCCCGCACCCGCACCGCAGGGTACGGCAGCCAGAACGGAGGGTGCCGCCATGAGGAGGAAGGCGAAGCTGGAGCAGGACCCGTGGTTGAGCGGCGGAGTCCACGGGGCCCCCGCACCCGCGCCGCAGAGTGCGGCAGCGAGAACGGAAGGTGCCGTCGTCACGAGGATGAAGACGAAGCTGGAGCATGACCCGTGGTTGGTGACCTTGGTGCGGCAGATGATATCTGTGGAGGTGGAGCGGCAGATGCATGGAGTGGGCCCGCAGGCCAGAAGCAGCGCCGGTGGTGGTGGTGGTGCAGACGGCGACGGCGTGAACGGCCAGGACACGTCGATGGACGTGGACCCG
TFome clones do not contain stop codon at 3'end.
translation: MVVSSSGGAGGVEGGSGCGVSASVPPVVSSSGGAGEVEGGDGGSAAVSGCRRRVKGSWTPEEDELLRRAITRHGPRNWTVISSEIPGRSGKSCRLRWCNQLSPSVERRAFTPEEDAIIVAAHAQHGNRWATIARMLHGRTDNSVKNHWNSTLLRQRRAAAAHASAAGCALQLRPATTASVPLRHLLDRPKEAAASVSFRRLDPKAEEEEDEDMDEGGSSSEDSAHRHRSLSPAPVEPLTLNLFSDGAHGLPTPAPAPAPQGTAARTEGAAMRRKAKLEQDPWLSGGVHGAPAPAPQSAAARTEGAVVTRMKTKLEHDPWLVTLVRQMISVEVERQMHGVGPQARSSAGGGGGADGDGVNGQDTSMDVDP