TFome Information for pUT5957

TFome Name pUT5957
Genbank Insert ID KJ727865
Protein Name ZmMYBR88
Species Maize
TF Family MYB-related
Gene ID GRMZM2G064328
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: C165_F 3' Primer Name: C165_R
5' Primer Tm (º C): 70.6 3' Primer Tm (º C):
5' Primer Sequence: caccATGGCCACAACGGCGACA 3' Primer Sequence: ACTCATGCTAGCCACGGGCTTTG
PCR Condition: 5 l GC buffer (NEB) 1 l primer forward 20mM 1 l pr
Nucleotide Sequence: ATGGCCACAACGGCGACAACGATGGCGCCGGTGACGGCGCCGGTGGCCACAGCCAACCTCGAACCTACACCAACACCTCTGCATCCACGTCCTGCCGCGCCACCTCATCTCCGGGCGCTTTCCACCTTGGCCCCCGTCAAGTCAGAGGCTCCTCCCACCCCCTCGTCTTCTACCGCCATCACCGCCGCAGCCGGAGCGGAGGATCCATCCTACATCATCACCGTCCCTAGTTATTCAGCGTGGTTCTCGTTCGACTCCATCCACGACACGGAGCGCCGCCTCCTGCCGGAGTTCTTCGTGGGGGAGGCCGCCGCGGCGTCAGGGTGCCGGGGCCCGCACGCGTACAAGTACTACCGCGACTCCCTGATACGGAGGTTCCGGGCGCGGCCGGGTCGACGGCTCACGCTCACGGAGGCTCGGAGGGGCCTTGTTGGCGACGTCGGCTCAGTCCGCCGCGTCTTCGATTTCCTTGAGGAATGGGGGCTTATCAACTACGGTGCTTTGCCATCGGGGTCAAAGCAAGCTAAAGAGAAGAGGGAAGAGGCTGCACAACAGTCCTCGTTGCCTTTTGGGGCAATTGCACCCAGGAAGCTCTGTACCGGTTGCCGCACCGTGTGTGGGCTTGCTTACTACGCCTGCGACAAGGCAGATATAAGTCTTTGTGCTAGATGCTATGTAAATAATAACTACCGGCCGGGCCTGTCTCCTGCTAACTTCAAGAGAGTTGAAATTACTGAAGATGCAAAACCAGATTGGACAGACAAAGAAACTCTTCACTTGCTTGAGGCTGTCTTGCATTATGGGGAAGACTGGAAAAAGGTGTCTGAACATGTTAGTAGTCGGTCAGAAAAAGATTGTATTGCAAGATTTATAAGGCTACCTTTTGGAGAACAGTTCATGGGACACAAGGAGGATAGAATGAGGTTTGAGAATACTGATGACAATACTGATGAGCCTGGAGCAAATGTCTCAAAACGACTACGTCTCACTCCACTAGCAGATGCAAGCAATCCGATTATGGCTCAGGTTGCATTTTTATCAGCCATTGTGGGTTCCGATGTTGCCTCAGCTGCAGCGCAAGCAGCTATTTCTGCCCAATCCCGTGTTGACCTTAATGACGGCGAGATTGAAACTTCAATAAATAGCATTAAGCAAGAAGAATCATCTCACACAAATGGGCTCTCAGCCAACGTGTTACTGAAAGAGGCAGCTGCTAATGCACGGGCACAACTCGAGAAGGAAAGGAACAGCATAGAGCAATCTTTATCAAACATAGTAGACGTCCAGATGAAGGAAATCCAAGATAAAATATGCCGGTTTGAGCAGAAGGAGATGCTGATGGAGAAAGAGCGGCAGCAGCTCCATTTTCTAAGGGATCTACTTTTCACAGACCAATTGGCAGTCATGCAGCATCAACAAAGGAGTCCAGCTGTAGCCACAGAGTGCAAGGGTGATGAGAAGCCAAAGCCCGTGGCTAGCATGAGT
TFome clones do not contain stop codon at 3'end.
translation: MATTATTMAPVTAPVATANLEPTPTPLHPRPAAPPHLRALSTLAPVKSEAPPTPSSSTAITAAAGAEDPSYIITVPSYSAWFSFDSIHDTERRLLPEFFVGEAAAASGCRGPHAYKYYRDSLIRRFRARPGRRLTLTEARRGLVGDVGSVRRVFDFLEEWGLINYGALPSGSKQAKEKREEAAQQSSLPFGAIAPRKLCTGCRTVCGLAYYACDKADISLCARCYVNNNYRPGLSPANFKRVEITEDAKPDWTDKETLHLLEAVLHYGEDWKKVSEHVSSRSEKDCIARFIRLPFGEQFMGHKEDRMRFENTDDNTDEPGANVSKRLRLTPLADASNPIMAQVAFLSAIVGSDVASAAAQAAISAQSRVDLNDGEIETSINSIKQEESSHTNGLSANVLLKEAAANARAQLEKERNSIEQSLSNIVDVQMKEIQDKICRFEQKEMLMEKERQQLHFLRDLLFTDQLAVMQHQQRSPAVATECKGDEKPKPVASMS