TFome Information for pUT5963

TFome Name pUT5963
Template Genomic DNA
Genbank Insert ID KJ727871
Protein Name ZmMYB123
Species Maize
TF Family MYB
Gene ID GRMZM2G172487
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: SE0067_F 3' Primer Name: SE0067_R
5' Primer Tm (º C): 61.7 3' Primer Tm (º C):
5' Primer Sequence: caccATGGAACAGGGGGACGATC 3' Primer Sequence: GCTAAAACAGCATGGACAGTGAGCA
PCR Condition: 5 l GC buffer 5 l 5x CES 1.5l MgCl2 50mM 1 l dNTPs
Nucleotide Sequence: ATGGAACAGGGGGACGATCATCGGAGGAAGATGGGCAGCAGGCCGCCATGGTGCGCGTGCGACAGGGCGGGGAATACGGCGGCGATGAAGAAGGGGCCATGGATGCCGGAGGAGGACCTCGTCCTCGTCTCCTACATCCACGAGCACGGCCCCACCAAGTGGCGCCACGTGCCCGCGAGCACGGGGCTGATGCGCTGCAGCAAGAGCTGCCGCCTCCGCTGGACCAACTACCTCCGCCCGGGCATCCGGCGCGGCAACTTCACGCCGCGCGAGGAGCGCGTCATCGTCCACCTCCACTCCCTGCTGGGCAACCGGTGGGCGGCCATCGCGTCGCATCTCCCGCAGCGCACCGACAACGACATCAAGAACTACTGGAACACCCACCTCAAGAAGAAGCTGGTCGTCGTCGAGGAACAGCACCGAGCGGCTGCGGCAGCAGCCATCGTCGCCGCCGCCGCTAGAGGACACGTCGACGACGACGGCGTCACCACCAGTAGTAGTCCCCGCCTGCTCGCCAAGGACGATAGCTACGGCTACGGCTACGACGCGCGCCCTGCTGCAGCCTATCCCTGTAGCATGGACAACGTATCCAAGCTTGTCAAAGTCAAAGCAGGTTGCATGAAGAGCGCATCATCGTCATCCCCGCCGGCGCAGGATGGTAGTAGTATCCGTCGTCCTTTCTTTTCACTCGACCAAACGTCCCGCAGTACGGCGCCGCTGCCACCCATCTCCAACGTGGTGCCGCAGCTAGCCGGTACGGTGTTGGCGGGACAGGGGCAGGGACGACACGGCGGGCGTTTCTTCCACGAGCCGCCCCAGCAGCAGCTGTCCTCAATAATGGAGAACTGGTTATTCCTCCCCAAGCACCAGCACCAGCAGCAGATGACGCAGAGCTCTCCGACTCCGACGGCTGCTGCTCACTGTCCATGCTGTTTTAGC
TFome clones do not contain stop codon at 3'end.
translation: MEQGDDHRRKMGSRPPWCACDRAGNTAAMKKGPWMPEEDLVLVSYIHEHGPTKWRHVPASTGLMRCSKSCRLRWTNYLRPGIRRGNFTPREERVIVHLHSLLGNRWAAIASHLPQRTDNDIKNYWNTHLKKKLVVVEEQHRAAAAAAIVAAAARGHVDDDGVTTSSSPRLLAKDDSYGYGYDARPAAAYPCSMDNVSKLVKVKAGCMKSASSSSPPAQDGSSIRRPFFSLDQTSRSTAPLPPISNVVPQLAGTVLAGQGQGRHGGRFFHEPPQQQLSSIMENWLFLPKHQHQQQMTQSSPTPTAAAHCPCCFS