TFome Information for pUT5974

TFome Name pUT5974
Genbank Insert ID KJ727881
Protein Name ZmMYB83
Species Maize
TF Family MYB
Gene ID GRMZM2G024468
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: B823_F 3' Primer Name: B823_R
5' Primer Tm (º C): 68.0 3' Primer Tm (º C):
5' Primer Sequence: caccATGGGGAGGCCGCCGTG 3' Primer Sequence: AAAGAACTCGCACGGGTCCGCC
PCR Condition: PCR Conditions: Volumes per reaction (25l): 5 l GC
Nucleotide Sequence: ATGGGGAGGCCGCCGTGCTGTGAGAAGGCCGGGTTGAAGAAGGGGCCCTGGTCGCCGGAGGAGGACCTCTTGCTCGTCTCCTACGTGCAGGAGCACGGTCCTGGGAATTGGCGCGCCGTGCCATGCAGCACCGGTCTGATGCGCTGCAGCAAGAGCTGCCGGCTCCGGTGGACCAACTACCTCCGCCCGGGCATCAAGCGCGGCAGCTTCAGCGACCAGGAGGAGAAGCTCATCATCCACCTCCAGGAGCTGCTCGGGAACAAGTGGTCCGCGATTGCGTCGTACCTGCCGGAGCGGACGGACAATGACATCAAGAACTACTGGAACACGCACCTCAAGAAGAAGCTCGCCAAGACGGGCGCCAGGGAAAGCGGTGCCAGCGCCAAGACGACGAAGAAGAGCGATAGGGCCGCGGCGCCCAAGGGGCAGTGGGAGCGGCGGCTGCAGACGAACATCCACACCGCACGCCAGGCGCTCCGGGAGGCGCTGTCCATGGACGACACTGCGCCGCCGGCAATCAAGCCGGAGCCGCTGCCGCTGCCGCTGGGGCAGCTGCCGGCGCCAGCCAGCCAGGCGATGTACGCTTCCAGCATCGATAACATAGCGCGTCTGCTGGAGGGCTGGATGCGTCCCAGCGTCAGTGGGAATGCGTCGGCTGAGTCCATGTCCTCCTTCTCGGCGTTCTCCGGTGGTGGCGACGGCGCGTCGGCAAGCCACATCGGCACGGCGCACACGCCGGAGGGGTTCACCGGCACGAGAAAGGAAGAGGGCGCGGGGCCGGGGCCGGCGTCATTACCAATGTTCGAGAACTGGCTGCTCGATGACGGCATGGGGAACGGTGATGCGTCCCTCATCTGCGTCCCGCTGGCGGACCCGTGCGAGTTCTTT
TFome clones do not contain stop codon at 3'end.
translation: MGRPPCCEKAGLKKGPWSPEEDLLLVSYVQEHGPGNWRAVPCSTGLMRCSKSCRLRWTNYLRPGIKRGSFSDQEEKLIIHLQELLGNKWSAIASYLPERTDNDIKNYWNTHLKKKLAKTGARESGASAKTTKKSDRAAAPKGQWERRLQTNIHTARQALREALSMDDTAPPAIKPEPLPLPLGQLPAPASQAMYASSIDNIARLLEGWMRPSVSGNASAESMSSFSAFSGGGDGASASHIGTAHTPEGFTGTRKEEGAGPGPASLPMFENWLLDDGMGNGDASLICVPLADPCEFF