TFome Information for pUT6487

TFome Name pUT6487
Template BT038466.1
Genbank Insert ID KJ728210
Protein Name ZmMYB30
Species Maize
TF Family MYB
Gene ID GRMZM2G171781
transcript T01
Vector pENTR/SD/D-TOPO
Note c.A371G p.N124S; c.T627C p.H209(=); c.G726A p.A242(=); c.C1009A p.P337T PZE08127729220 c.T1056A p.V352(=) PZE08127729267 c.G1092A p.T364(=); c.A1160G p.N387S PZE08127729371 c.A1164C p.I388(=) present in template FlcDNA. None present in Myb-domains.
Request Information: Deposited to ABRC
5' Primer Name: B305_F 3' Primer Name: B305_R
5' Primer Tm (º C): 72.0 3' Primer Tm (º C):
5' Primer Sequence: caccATGGGGAGGCATTCTTGCTGCTACA 3' Primer Sequence: GATATTCTCAAAAGATAGTTGCATTCTTT
PCR Condition: 5 l GC buffer (NEB) 1 l primer forward 20mM 1 l pr
Nucleotide Sequence: ATGGGGAGGCATTCTTGCTGCTACAAGCAGAAGCTGAGAAAGGGGCTCTGGTCCCCTGAGGAGGATGAGAAACTCATGAATCACATAACAAAGCATGGCCATGGCTGCTGGAGCTCTGTTCCCAAACTCGCTGGGCTTCAAAGGTGCGGAAAGAGTTGTAGGCTGAGGTGGATAAACTATCTGAGGCCAGACCTCAAGAGAGGGGCATTCGCCCAAGACGAAGAAGACCTCATCATCGAGCTGCACGCTGTCCTCGGGAACAGGTGGTCTCAAATTGCAGCGCAGCTGCCAGGGAGGACTGATAATGAGATCAAGAATCTATGGAACTCGTGCATCAAGAAGAAGCTGAGGCAGAAAGGCATTGATCCCAGCACCCACAAGCCACTTACTGAGGCTGATCGCGGCGGTGCAGCTCCCACCATCAGCACCGAGAGAACCTCAGGGTCCAGCGACGTCAACCCATCAAGCACTGGTCCTCTGGGGAACTTGAGCCCCCTCCTCAGCGAGACGGCTCAATCATCAATGCTGATGCCCGTGTACGACAAGAATCGTGCTGAAACACCAAACTTGGCACGCCCTAAGCTGCCACCAAAGGAGCTGTTCCTGGAGCAGCTTACTGCTGGACACGAGAGTCCATCAACCTGCCACTCATCAGGCCAAACTCTCTATTTCCCTTTCCAACAGCCTTTAGGCTACAACAGTGAGAGTGGCAGCAGCGATGGGGCAAATATGAATTCACTCTGGTTCAACCAGAGTGACTTCAACTGCAGCACAATTTCTACAGTGATGCCGCCAGTTTCACCATCGGCCCTCTCTACATCAATGGGGCTGAATCTTCCACCTGATAATCCTCGACATGGAGGAACTGGCATTGGAAGTACCGCAGTAGATTCATTCTACTGGGATGGTACTAATCCTAGCAGCAGTAGCAGTACTGGGAGCAGAGGGAGCAACAGTATGGGATTTGAACCACAGAGCACGAGCACAATTCTGGAGAACAGTGTCTTCACATGGACAGACATTGGACAAGAAAAAGATACAAGGGCTCACCTAGTAGCGGAACTTAAGTGGCCTGACTCCTTTGCCGAGACAACCACAGCCATGCAGAACCAGAGCCAAACGCTTTATGATGATGTGATCAAGGCAGAGAGCCAATTCAGCATCGAAGGGATATGTGCTTCTTGGTTCCAGAATCAGCAGCCACAGCAACAGCTGCAGGTAGCACCAGACATGTATGACAAGGACTTGCAAAGAATGCAACTATCTTTTGAGAATATC
TFome clones do not contain stop codon at 3'end.
translation: MGRHSCCYKQKLRKGLWSPEEDEKLMNHITKHGHGCWSSVPKLAGLQRCGKSCRLRWINYLRPDLKRGAFAQDEEDLIIELHAVLGNRWSQIAAQLPGRTDNEIKNLWNSCIKKKLRQKGIDPSTHKPLTEADRGGAAPTISTERTSGSSDVNPSSTGPLGNLSPLLSETAQSSMLMPVYDKNRAETPNLARPKLPPKELFLEQLTAGHESPSTCHSSGQTLYFPFQQPLGYNSESGSSDGANMNSLWFNQSDFNCSTISTVMPPVSPSALSTSMGLNLPPDNPRHGGTGIGSTAVDSFYWDGTNPSSSSSTGSRGSNSMGFEPQSTSTILENSVFTWTDIGQEKDTRAHLVAELKWPDSFAETTTAMQNQSQTLYDDVIKAESQFSIEGICASWFQNQQPQQQLQVAPDMYDKDLQRMQLSFENI