TFome Information for pUT6488

TFome Name pUT6488
Genbank Insert ID KJ728211
Protein Name ZmEREB60
Species Maize
TF Family AP2-EREBP
Gene ID GRMZM2G131266
transcript T01
Vector pENTR/SD/D-TOPO
Note c.G236T c.C237T p.G79V; c.A238T c.T239A c.C240T p.I80Y; c.G241C c.C242T c.A243C p.A81L Present in functional domain. Present in template FlcDNA BT069847.1.
Request Information: Deposited to ABRC
5' Primer Name: B394_F 3' Primer Name: B394_R
5' Primer Tm (º C): 73.0 3' Primer Tm (º C):
5' Primer Sequence: caccATGGCCAGGCCCCGCAA 3' Primer Sequence: CTCGTACAGGTCGAAGTCGAACATTGGC
PCR Condition: 5 l GC buffer (NEB) 1 l primer forward 20mM 1 l pr
Nucleotide Sequence: ATGGCCAGGCCCCGCAAGAACGGCGGTACCGACGAGGATGATGCTAACGCCGCCACGGGAGCCACCGGGAAGCCGAAGAAGCTGATGAAGCGGGCGCGGAGGAAGAGCGAGAGCCCCTCCCCGCGCAGCTCCGCGTACCGCGGCGTCACACGGCACCGGTGGACGGGGCGGTTCGAGGCGCACCTGTGGGACAAGGACGCCCGCAACGGCTCCCGGAGCAAGAAAGGCAAGCAAGTTTATCTCGGCGCGTACGACGACGAGGACGCGGCGGCGCGCGCGCACGACCTGGCGGCGCTCAAGTACTGGGGCCCCGCCGGCACCGTCCTCAACTTCCCGCTGAGCGGCTACGACGAGGAGCGGAGGGAGATGGAGGGGCAGCCCCGGGAGGAGTACGTCGCGTCGCTGCGGCGGCGGAGCAGCGGCTTCGCGCGAGGGGTGTCCAAGTACAGGGGCGTTGCCAGGCATCATCACAACGGGAGATGGGAGGCGAGGATCGGGCGCGTGTTAGGCAACAAGTACCTCTATCTCGGCACTTACGCAACACAAGAGGAGGCGGCAGTGGCGTATGACATGGCGGCTATAGAACACCGCGGCTTCAACGCGGTCACCAACTTCGACATCAGCCATTACATCAACCACTGGCATCGACATTGCCATGGCCCCTGCGACGGCAGCCTCGGCGCGATGGACGTCGCACCGAACGTCTCGCTCGAACTAGACCTACTCGAGTGCCCGGCCACCGTCGGCCTCGGCCTCGAGGAGACCACGGGCGACGATGAATTCCACAACCGCGAGGACTACCTGGGGCACCTTTTCGGCGTGCAGCAGCTTCCCGACGAGATGGGGCCGCCGGCTCATCAGATGGCACCAGCATCGTCGGCGCTCGATCTGGTGTTGCAGTCGCCTAGGTTCAAGGAGCTGATGCAACAGGTTTCCGCGGCGGGAGCCTCCGAGACCAACGGCGGCAGCATGCGTAGCTCGCCATCAACGTCCCTGTGTTCGTTCTCGCCTTCGCCTCTGGAGCTGCCATCGCCGCCGCTACAGCAACCTACTGAATTCATCGATGGCGCGCCGCCGCGGTGCAGCTTCCCGGATGACGTGCAGTCGTTCTTCGATTTCAAGAACGATAACGACATGAGCTTCGTCTACGCGGAGGTTGACACATTCCTCTTCGGCGACCTAGGCGCATACGCTCCGCCAATGTTCGACTTCGACCTGTACGAG
TFome clones do not contain stop codon at 3'end.
translation: MARPRKNGGTDEDDANAATGATGKPKKLMKRARRKSESPSPRSSAYRGVTRHRWTGRFEAHLWDKDARNGSRSKKGKQVYLGAYDDEDAAARAHDLAALKYWGPAGTVLNFPLSGYDEERREMEGQPREEYVASLRRRSSGFARGVSKYRGVARHHHNGRWEARIGRVLGNKYLYLGTYATQEEAAVAYDMAAIEHRGFNAVTNFDISHYINHWHRHCHGPCDGSLGAMDVAPNVSLELDLLECPATVGLGLEETTGDDEFHNREDYLGHLFGVQQLPDEMGPPAHQMAPASSALDLVLQSPRFKELMQQVSAAGASETNGGSMRSSPSTSLCSFSPSPLELPSPPLQQPTEFIDGAPPRCSFPDDVQSFFDFKNDNDMSFVYAEVDTFLFGDLGAYAPPMFDFDLYE