TFome Information for pUT6499

TFome NamepUT6499
Genbank Insert IDKJ728222
Protein NameZmOrphan249
Species Maize
TF Family Orphans
Gene ID GRMZM2G177386
transcript T03
VectorpENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: B923_F 3' Primer Name: B923_R
5' Primer Tm (º C): 71.2 3' Primer Tm (º C):
5' Primer Sequence: caccATGAGGCTCGCACTGAAGAAGGGTA 3' Primer Sequence: TGAGTTGCTCTTGGCCTTCTTTCG
PCR Condition: 10 l GC buffer (Thermo Fisher) 2 l primer forward
Nucleotide Sequence: ATGAGGCTCGCACTGAAGAAGGGTACCGAGGACAATATCACTGTCATTGTGGTTGACTTGAAACCTCGAAAGAAGGCCAAGAGCAACTCA
TFome clones do not contain stop codon at 3'end.
translation: MRLALKKGTEDNITVIVVDLKPRKKAKSNS