TFome Information for pUT6548

TFome Name pUT6548
Genbank Insert ID KJ728271
Protein Name ZmGATA30
Species Maize
TF Family C2C2-GATA
Gene ID GRMZM2G464037
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: P10up 3' Primer Name: P10dn
5' Primer Tm (º C): 63.6 3' Primer Tm (º C):
5' Primer Sequence: caccATGAGCAATCAACCACCTCACGC 3' Primer Sequence: TGACCCAGCTGTTCCGTTCTGC
PCR Condition: mix per 25l reaction: 5 l GC buffer 5 l 5x CES 1.5
Nucleotide Sequence: ATGAGCAATCAACCACCTCACGCCTCGCTGCAGGATGACCTCCCGGACTGCGACGGCGACGACCCGCTCGCCCTTGCCATCCGGCTCTTCCCCGCCCACACCACCGGCGCGGGTCTATCGCCGGCGGCGCTCGGCATAGGCCGCGTCGCCGAGCCGCCCCGTCGGGAGCAGGAGCCACTGGCTAATAGCACGTATGGCGTACGCGGAGCCGGGCCGGATCCTTGGGGCCTGCGCCTGTCCAGGTCCGTTCTTGGGGGCCTCGACGGATTTGACGTGGACACATTCTTTGCTGACGACGCGCTGGACGGCGGCGGCGAGGCGACCGAAGGCGACTCGCCGCCGGCGCACGTGACAGCCGCCGCGCGCGGCTCGTTGGCCAACGACGACGCGTCGCCGTTGCCCGCGGCCATGCCAGCCGTCGCCCTTGAAGCGTACGACGCGTGCAGTGCACCTGTGCCAGCAGCATGCGGTGGCGCGCCGCCCGTCCTTGTCGCCAACAACAGCATGCCGCCAGCTAGCTGTCTCGGCGCGCGCGGTGCACTTTACATTGTCTCCAAACGCACACGCACGCATGCGCCGCCGCCACTAGCGGCGGAATCCATGACACCGGCAGTCGCTCCTCCTCCAGCCATGCCCGACGGTGGGAACGGTGGCAATAACCGGAGCGCCGCCTTACCTGTCGCTCTCGCTCCTCCGTCCGGGAGTACCGGTGGCGCCGTCCGCCGGCGCCGTCCCGTGCCACGCCCGCGGAACAGGGAAGTCCAGAGGACGTGCAGCCACTGCCAGTCGTCAAAGACGCCGCAGTGGCGCGAGGGCCCGGACGGGCGAAGAACCCTGTGCAACGCGTGCGGGCTACGCTACAAGTCGCATAGGCTGGTGCCTGAGTACCGGGCCGCAGAATCCATGACACCACGCGATCTCCACCCAAACGCTGGGCTGGTCGGCGCGTCTTCAGGTCCGAGCAGCCGCCCGTCGTCGTCATCTACAACGACGCCATCGCAGTCGCAGATCGACTTCCCATCCCACGCCTTGCCGGCAGTCGCTCCTCCTCCAGCCATGCCCGATCCCGACGGTGGGAACGGTGGCAATAACCGGAGCGCCGCCTTGCCTGTCGCTCTCGCTCCTCCGTCGGGGAGTACCGGTGGCGCCGTCCGCCGGCGCCGTCCCGTGCCATGCCCGCGGAACAGGCAAGTTCAGAGGACGTGCAGCCACTGCCAGTCGTCGGAAACGCCGCAGTGGCGCGAGGGCCCGGACGGGCGAAGAACCCTGTGCAACGCGTGCGGGCTACGCTACAGGTCGCATAGGCTGCTGCCTGAGTACCGGCCGACGACGTCTCCTAGCTTCCAGATCGGGCAGCACTCTAATCGCCATCGGAGGATTATGCAGATCAGGGAGCAGAACGGAACAGCTGGGTCA
TFome clones do not contain stop codon at 3'end.
translation: MSNQPPHASLQDDLPDCDGDDPLALAIRLFPAHTTGAGLSPAALGIGRVAEPPRREQEPLANSTYGVRGAGPDPWGLRLSRSVLGGLDGFDVDTFFADDALDGGGEATEGDSPPAHVTAAARGSLANDDASPLPAAMPAVALEAYDACSAPVPAACGGAPPVLVANNSMPPASCLGARGALYIVSKRTRTHAPPPLAAESMTPAVAPPPAMPDGGNGGNNRSAALPVALAPPSGSTGGAVRRRRPVPRPRNREVQRTCSHCQSSKTPQWREGPDGRRTLCNACGLRYKSHRLVPEYRAAESMTPRDLHPNAGLVGASSGPSSRPSSSSTTTPSQSQIDFPSHALPAVAPPPAMPDPDGGNGGNNRSAALPVALAPPSGSTGGAVRRRRPVPCPRNRQVQRTCSHCQSSETPQWREGPDGRRTLCNACGLRYRSHRLLPEYRPTTSPSFQIGQHSNRHRRIMQIREQNGTAGS