TFome Information for pUT6564

TFome Name pUT6564
Template BT042239.1
Genbank Insert ID KJ728285
Protein Name ZmMYB75
Species Maize
TF Family MYB
Gene ID GRMZM2G070849
transcript T01
Vector pENTR/SD/D-TOPO
Note c.G213T;G694A;G966T; p.V232I;W322C; Not present in template FlcDNA sequence. Not present in functional domains.
Request Information: Deposited to ABRC
5' Primer Name: B299_F 3' Primer Name: B299_R
5' Primer Tm (º C): 70.7 3' Primer Tm (º C):
5' Primer Sequence: caccATGGACATGGCGCACGA 3' Primer Sequence: CACGCCCTGCGCCTGCGTGAACC
PCR Condition: Volumes per reaction (25l): 5 l GC buffer (Thermo
Nucleotide Sequence: ATGGACATGGCGCACGAGAGATCAGACGCCAGCAGCGAGGAGGAGGTGATGGCCGGCGAGCTGCGGCGCGGGCCTTGGACGGTGGAGGAGGACCTCCAGCTGGTCAACTACGTCGACGCGCACGGCGAGGGCCGCTGGAACTCGCTCGCCCGATCAGCAGGTCTGAAGCGCACTGGCAAGAGCTGCCGCCTCCGGTGGCTGAACTACCTCCGTCCCGACCTCCGGCGCGGCAACATCACGCCGCAGGAGCAGCTGATGATCCTGGAGCTGCACTCGCGCTGGGGCAACCGCTGGTCCAAGATCGCGCAGCACCTCCCCGGGCGCACCGACAACGAGATCAAGAACTACTGGCGCACGCGCGTGCAGAAGCACGCCAAGCAGCTCAAATGCGACGTCAACAGCCAGCAGTTCAAGGACGTGATGCGCTACCTCTGGATGCCCCGCCTCGTCGAGCGCATCCAGGCCGCCGCAGCCAACAATAACGCCAGCGGCGCCGGGGTTCCGCCAGCTGGCGCCGCCGCGGACGACACGCCGCTCTCGTCGTCGTGGCAGCACGGCGGCGGCGCCGACGACGACGGCGGCCTCTACGCGTCGCCGGAGCTGCCCACGGACGCCTGCTGGCCTCCCGCAGACTGCTACTACTACCCAGCCGCCGCTGACCACCAGCTACTGAACAACCCCGCCGCCGCCGCCATCTTCCCGGACCTGTCAAGCACCACGGCCGGGTCGTCCTCTCCGTCCTCGGATTCCGGCGCGGGGACAGCACAACCCTGGCCCGCGCCGCTGGGTGGCGCAGAGTGGTTGACCACCGGCGCCTGCTGCGACGCCTCCAGCGCCGCCGCCGCCCTGGGCGGGCAGCAGCAACAATCGTGCCTGGTCGGGGAGACGTCGTGGGCGTCATCCGAGCTCCCCGAGCTGGGCGTCGCGGACTTCGAGATCGGCAGCTTCGACGTGGAGAGCATCTGTAGCATGGACGACAGCCTGTGGTTCACGCAGGCGCAGGGCGTG
TFome clones do not contain stop codon at 3'end.
translation: MDMAHERSDASSEEEVMAGELRRGPWTVEEDLQLVNYVDAHGEGRWNSLARSAGLKRTGKSCRLRWLNYLRPDLRRGNITPQEQLMILELHSRWGNRWSKIAQHLPGRTDNEIKNYWRTRVQKHAKQLKCDVNSQQFKDVMRYLWMPRLVERIQAAAANNNASGAGVPPAGAAADDTPLSSSWQHGGGADDDGGLYASPELPTDACWPPADCYYYPAAADHQLLNNPAAAAIFPDLSSTTAGSSSPSSDSGAGTAQPWPAPLGGAEWLTTGACCDASSAAAALGGQQQQSCLVGETSWASSELPELGVADFEIGSFDVESICSMDDSLWFTQAQGV