TFome Information for pUT6565

TFome Name pUT6565
Genbank Insert ID KJ728286
Protein Name ZmHB38
Species Maize
TF Family Homeobox
Gene ID GRMZM2G013617
transcript T01
Vector pENTR/SD/D-TOPO
Note c.G479T p.G160V Not present in template FlcDNA, not located in functional domain.
Request Information: Deposited to ABRC
5' Primer Name: C253_F 3' Primer Name: C253_R
5' Primer Tm (º C): 63.3 3' Primer Tm (º C):
5' Primer Sequence: caccATGGCCATCCACCACCC 3' Primer Sequence: CCCAGCGAAATGATGCAGCAA
PCR Condition: 5 l GC buffer (NEB) 1 l primer forward 20mM 1 l pr
Nucleotide Sequence: ATGGCCATCCACCACCCGCACCTCCTCGACTTCTCGCCGCCTCCGAACACGGTGGCCATGGAGGAGGCGCCGCCCCCACCCCACTTCGACCACGGCCTCCTCGGGCTCCATGTCGATGGCATGCCTCATCGCGTCCTCGCCGACGACGCGCCGGTGGCGGCATGGGCGCCGCAGGCCGTGGTCTCCCACTCCCTGTACGGATACGATAACACAGCAGCGGGGGCGTCGTCGCTGTTTGGCCACCATGAGGCATCAGAGGCCCAGTTCTCCGTGCTTCCGCCGGCAGCGTCGTCGTTTGCACTACTACCTAACCACCACCACCAGCAGCAGCTGCCGACGACGACGGCGGCGTCGAGCATGCAGCAGCCGTTCCAGCTGAGGAGCTCCAAGTACCTGGGTCCTGCGCAGGAGCTGCTCGCCGAGTTCTGCAGCCTGGAAGGGGACCTGCTGCACGCCACGAACAAGCAGGGAGCTTCCGTAGCAGCAGCAGGTAACAGCAGGTGGGACGACGTGGAGACGTCGTCGTCTTCTTCTGCTGGCCTCTGGGGGCACCTGTCCCTGAGCTCCATGGATCTCCTGGAGCTCGAGAGGAGGAAGGCCAGGCTCTTGTCCATGGTTGAAGAGGTGGACCGGCGGTACCGGCGATACCGCGAGCAGATGAGGTCAGTGGAGGTGTCGTTCGAGGCGGTGGCCGGAGCCGGCGCGTCGCAGGTGTACACGCGGCTGGCGCTGCGGGCCATGTCGCGGCACTTCCGGTGCCTGCGGGATGCGCTGGTGGCGCAGGTGCGCGCTCTGCGGAAGGCCATGGGGGAGAGGGACGGCGGCCCAGCTGGTGCGGCGGCGGGCGCCACCAAGGGCGACACGCCCAGGCTCAAGGTGTTGGACCAGTGCCTGCGGCAGCAGCGGGCGTTCCAGCACCCGGGCACCATCGACAACTACCCGTGGCGGCCCCAGCGCGGCCTGCCGGAGCGCGCCGTCGCCGTCCTCCGAGCCTGGCTCTTCGAACACTTCCTCCACCCGTATCCGAACGATGTGGACAAGCACATTCTAGCGCGCCAGACAGGACTGTCAAGAAGCCAGGTTTCCAATTGGTTCATCAACGCCAGGGTGAGGCTGTGGAAGCCGATGATAGAGGAGATGTACACGGAAGAAGTGAACCCGAAACCGGCCGACGACACAAGCCAAAACCCTAGCGCCGGTGGCGGCGTCGGCGTCGGCGTCGCCATCAAACCTGAGCAGCAGGTGAGCACAGCTGCGGCGGGAGCCACCATCGGAGGCGGCGGCGGCGACCATCTGTTCGGTCCTAGTTATCCCAGCATGTACGGGAGCCACGGCGGCGCCGTGTCGCTTACCCTAGGGCTCCAGCAGCAGCCGTTTGCGTCGACGATGATGCACCAGCGACGACCACTGATGACGTTTCAAGGTGACGAGCAAGAGCCGGCGCTGCCGTACAGAGACCTTATGGGCTCTCAGTTGCTGCATCATTTCGCTGGG
TFome clones do not contain stop codon at 3'end.
translation: MAIHHPHLLDFSPPPNTVAMEEAPPPPHFDHGLLGLHVDGMPHRVLADDAPVAAWAPQAVVSHSLYGYDNTAAGASSLFGHHEASEAQFSVLPPAASSFALLPNHHHQQQLPTTTAASSMQQPFQLRSSKYLGPAQELLAEFCSLEGDLLHATNKQGASVAAAGNSRWDDVETSSSSSAGLWGHLSLSSMDLLELERRKARLLSMVEEVDRRYRRYREQMRSVEVSFEAVAGAGASQVYTRLALRAMSRHFRCLRDALVAQVRALRKAMGERDGGPAGAAAGATKGDTPRLKVLDQCLRQQRAFQHPGTIDNYPWRPQRGLPERAVAVLRAWLFEHFLHPYPNDVDKHILARQTGLSRSQVSNWFINARVRLWKPMIEEMYTEEVNPKPADDTSQNPSAGGGVGVGVAIKPEQQVSTAAAGATIGGGGGDHLFGPSYPSMYGSHGGAVSLTLGLQQQPFASTMMHQRRPLMTFQGDEQEPALPYRDLMGSQLLHHFAG