Tfome Clone Information

TFome Information for pUT3040

TFome Name pUT3040
Template BT067260.1
Genbank Insert ID JX428446
Protein Name ZmTUB2
Species Maize
TF Family TUB
Gene ID GRMZM5G866954
transcript T02
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: UT2916up 3' Primer Name: UT2916dn
5' Primer Tm (º C): 60.3 3' Primer Tm (º C):
5' Primer Sequence: caccATGTCATTTCGTAGCATAGTCCGTGATG 3' Primer Sequence: TTCACAGGCTAACTTTGTATCAAAGCTACTC
PCR Condition: Step 1, 98°C 30 sec melt, 1 cycle; Step 2, 98&
Nucleotide Sequence: ATGTCATTTCGTAGCATAGTCCGTGATGTTAGGGATGGCTTCGGCAGCTTGTCAAGGAGAAGCTTTGAGGTGACCCTCGCAAGCATTTATGGCCTTACTGGGCATCACAAAGGGAAGACCCAGAGCTCATCACATGTGCTCGACGACTCACCTTCCATAATTCGTGAAAGTCGATGGGCGAATCTACCTCCTGAACTCATCCGTGATATCATACGGAGACTGGAGGCTGATGAGAGCACCTGGCCAGCGCGGAAGCACGTCGTTTGCTTCGCAGCTGTTTGTAGGACATGGAGAGAAATGTGTAAAGAGATTGTGTTGAGCCCGGAGTTTTGTGGCAAGCTCACCTTCCCTGTGTCTCTAAAACAGCCTGGTCCTCGAGATGGAAATACAATGGTCCAGTGTTTTATAAAGAGGAATAAGTCAAAATCCACTTACCATCTCTACCTGTGCCTTAGCAATGTTGTTACTTCAGAAAGTGGGAAATTCCTCTTATCAGCTAAACGACACCGCAAAACCACATGCACCGAGTACACTATATCAATGGATTCTGGCAACATCTCAAGATCAAAAAGAACCTACATTGGAAAAATAAGGTCTAACTTCCTTGGCACAAGATTTTTAATTTATGATACACAACCGCCCTATAATGGGGCTGTAGTTCCTCCTGCCGGAAGGACAAGCAGGAGGTTCAACTCCACAAAAGTCTCTCCAAAGCTGCCTTCAGTCAGTTACAACATCGCACAGGTATCGTATGAGTTAAATGTCCTTGGCACGAGAGGTCCTAGGCGGATGCGTTGCATCATGCACTCCATACCTGCATCATCAGTGGAGCCAGGTGGCACAGTGCCTGGACAGCCAGAGCAGATTGTACCTCGAGCCCTGGAGGATTCATTCCGCAGCACGGCTTCCTTCTCGCAGTCGTTCCGTAGCACTGCCTCATTCTCCAAGTCCATCATGGACTCATCCATGGATTTCAATAGCGCTCGCTTCTCTGACATCGCTGGCAGCAGCGCTCGCTTCACGGGCGTTCCTGGTAGCAGCGCTCGCTTCGCGGGCGTTCCTGGCAGCAGCGCTCGCTTCTCGGGCATTGCTGGCGCCAGACTGGACAACGACGAGGAGAGTGAAACCAAGGAGAGGCCACTGGTGCTTCGTAATAAGCCGCCTAGGTGGCACGAACAGCTGCAGTGTTGGTGCCTCAACTTCCGTGGCCGTGTGACAATTGCCTCGGTGAAGAACTTCCAGCTGATCGCCGCGGCTACCCCGCCACCGGCAGGTGCGCCAACCCCCTCTCAGCCTGCCCCGTCAGATCCCGACAAGGTGATTCTCCAGTTTGGCAAAGTGGCAAGGGATATGTTCACGATGGACTATCGCTACCCTCTCTCGGCTTTCCAGGCCTTTGCCATTTGTCTGAGTAGCTTTGATACAAAGTTAGCCTGTGAA
TFome clones do not contain stop codon at 3'end.
translation: MSFRSIVRDVRDGFGSLSRRSFEVTLASIYGLTGHHKGKTQSSSHVLDDSPSIIRESRWANLPPELIRDIIRRLEADESTWPARKHVVCFAAVCRTWREMCKEIVLSPEFCGKLTFPVSLKQPGPRDGNTMVQCFIKRNKSKSTYHLYLCLSNVVTSESGKFLLSAKRHRKTTCTEYTISMDSGNISRSKRTYIGKIRSNFLGTRFLIYDTQPPYNGAVVPPAGRTSRRFNSTKVSPKLPSVSYNIAQVSYELNVLGTRGPRRMRCIMHSIPASSVEPGGTVPGQPEQIVPRALEDSFRSTASFSQSFRSTASFSKSIMDSSMDFNSARFSDIAGSSARFTGVPGSSARFAGVPGSSARFSGIAGARLDNDEESETKERPLVLRNKPPRWHEQLQCWCLNFRGRVTIASVKNFQLIAAATPPPAGAPTPSQPAPSDPDKVILQFGKVARDMFTMDYRYPLSAFQAFAICLSSFDTKLACE