Tfome Clone Information

TFome Information for pUT3042

TFome Name pUT3042
Template BT034213.1
Genbank Insert ID JX428448
Protein Name ZmTUB6
Species Maize
TF Family TUB
Gene ID GRMZM2G176340
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: UT2937up 3' Primer Name: UT2937dn
5' Primer Tm (º C): 63.8 3' Primer Tm (º C):
5' Primer Sequence: caccATGTCTCTCAAGAGCATTGTGCGGGA 3' Primer Sequence: TTCGCAGGCCGGTTTGGTGTC
PCR Condition: Step 1, 98°C 30 sec melt, 1 cycle; Step 2, 98&
Nucleotide Sequence: ATGTCTCTCAAGAGCATTGTGCGGGAGCTGAAGGAGATGAGGGACGGTATCGGGAGCATGTCGAGACGCGGCGGCAGCGGCTCCGACGGGCGTGCCTTCCACGGCCGCTCGGGGTCGCGGCATTCTTGGCCCAGCCTGTGGGCGGAGCAGCAACAGTCGCATCGGCAGGGCCAGGGCCTGGGTCCGGGCCCGGAGGGGCCGCATCATCAGCATCAGGGGCGGTGGGCGAACTTGCCTCCGGAACTGCTGCTGGATGTGATACAGAGGGTGGAGTCCAGCGAGGCGACGTGGCCGGCGCGGCGCCAGGTCGTGGCATGCGCAGCCATTTGCCGATCATGGCGCGAGGTCACCAAGGAGGTGGTGAAGACGCTCGAGGAGTGTGGCAGGATCACCTTCCCCATATCCCTTAAGCAGCCGGGGCCTCGTGAAATGCCGGTCCAATGTTTTGTGAGGAGGGAGAGGGCAACATCCACATATCTACTCTACCTAGGGCTCAGCCCATCTATGAATGTGGAGAAAGACAAGTTATTGCTTGCTGCCCGTAAGGTCAGGCGTGCCACAAGGACTTATTTTGTGATATCACTGGTCTCTGATGATTTCTCTCACTCTAGTAGCACCTACGTTGGCAAACTGAAGCCAAACTTCCTCGGCACAAAGTTCACAATCTTCGACAGCCAGCCTCCTCCTGACGCTGTAGTGCTACCAAACAATAAGACAAGCAAAAGGCAGTCCAAGCAAGTATCACCGAGACTGCCGCTAGGCAATTACAATGTTGCTACAGTCACGTACGAGCTCACCGTCCTACGCAACAGGGGTCCAAGGAGAATGCAATGCACCATGCACTCAATACCAGCTGAGTGCATCCAGGAGGGCGGGAAGGCCCCTACCCCTACAGGCGCCATCCAGTCGCTTGACGAGCCAGTGTCGTCCACCTTACCTAGTGCCAAAGGGAAGGAAGTGGCTGTAGAATTCTCTTCGACAAGCCTCAGCGCCGATCTGTCTGGACCGGCCTGCGTGAACGGAACACCTCTAGTGCTGAAGAACAAAGCTCCTCGTTGGCATGAGCAGCTGCAGTGTTGGTGCCTCAACTTCCGGGGGCGTGTCACCGTCGCGTCAGTGAAGAACTTCCAGCTCGTCGCCTCTGTTGATCCTTCCCTAAACATCCCCGCAGCGGAGCAGGAGAAGGTGATCCTCCAGTTTGGGAAGATAGGCAAGGATATATTCACCATGGACTACCGGTACCCACTCTCGGCGTTCCAGGCCTTTGCGATCTGCCTGACCAGCTTCGACACCAAACCGGCCTGCGAA
TFome clones do not contain stop codon at 3'end.
translation: MSLKSIVRELKEMRDGIGSMSRRGGSGSDGRAFHGRSGSRHSWPSLWAEQQQSHRQGQGLGPGPEGPHHQHQGRWANLPPELLLDVIQRVESSEATWPARRQVVACAAICRSWREVTKEVVKTLEECGRITFPISLKQPGPREMPVQCFVRRERATSTYLLYLGLSPSMNVEKDKLLLAARKVRRATRTYFVISLVSDDFSHSSSTYVGKLKPNFLGTKFTIFDSQPPPDAVVLPNNKTSKRQSKQVSPRLPLGNYNVATVTYELTVLRNRGPRRMQCTMHSIPAECIQEGGKAPTPTGAIQSLDEPVSSTLPSAKGKEVAVEFSSTSLSADLSGPACVNGTPLVLKNKAPRWHEQLQCWCLNFRGRVTVASVKNFQLVASVDPSLNIPAAEQEKVILQFGKIGKDIFTMDYRYPLSAFQAFAICLTSFDTKPACE