Tfome Clone Information

TFome Information for pUT3227

TFome Name pUT3227
Template DV030475.1
Genbank Insert ID JX469965
Protein Name ZmNAC17
Species Maize
TF Family NAC
Gene ID GRMZM2G062009
transcript T01
Vector pENTR/SD/D-TOPO
Note c.C291T p.(=) Present in template FlcDNA.
Request Information: Deposited to ABRC
5' Primer Name: UT2512up 3' Primer Name: UT2512dn
5' Primer Tm (º C): 58.1 3' Primer Tm (º C):
5' Primer Sequence: caccATGGCATTGAGGGAGATCGAGT 3' Primer Sequence: CCTCCACACTTGAGGGAACTCAT
PCR Condition: Step 1, 98°C 30 sec melt, 1 cycle; Step 2, 98&
Nucleotide Sequence: ATGGCATTGAGGGAGATCGAGTCGACGCTGCCACCGGGGTTCAGGTTCTACCCGAGCGACGAGGAGCTGGTGTGCCACTACCTCCACAAGAAGGTGGCCAACGAGCGCATCGCGCAGGGGACGCTCGTCGAGGTGGACCTGCACGCCCGCGAGCCGTGGGAGCTCCCAGAGGTGGCGAAGCTGACGGCCACCGAGTGGTACTTCTTCAGCTTCCGGGACCGCAAGTACGCCACGGGGTCGCGCACCAACCGCGCCACCAGGACGGGCTACTGGAAGGCCACGGGCAAGGATCGCGAGGTGCGCAGCAGCAGCAGCGCCACCGCCGTCGTCGTCGGCATGCGCAAGACGCTCGTCTTCTACCGGGGCAGGGCCCCCAACGGCGTCAAGTCCGGCTGGGTCATGCACGAGTTCCGCCTCGACACCCCGCATTCGCCGCCAAGGGAGGACTGGGTGCTGTGCAGGGTGTTCCAGAAGACGAAAGCCGCCGACGGCGACGGCGATGGCGGCGCCCAAGACGGCGACTCCTCGTCCCCGCCGGCCGCCTTCACCGGCCCGTCACGGCCACGCGCCGTGTCAGAGCCGCCGGACCATTCCGCGCCGCCGGCGGGAGGAGGCTACTACTACGGCCTCGCGTTCGGGCCGCGGCAGGTGGAGGTGGCGCAGCAGCAGTGTTACGGCGGCGGCGGCGCCACGGTCGCCGACCACCACCACGGCTTCACGCGAGACAGCGGGGGCGCTGCAGGGTTTGGCGCGACGTGGGGAGGAGGAGTCGCCGGCGGTGAGTGCGGGGCTGGCTACCTCGATATGGACGGCGCCTTTGACGTCATGATGGCCGGCTGCTTTGGCGGTGGAGACATGGATGAGTTCCCTCAAGTGTGGAGG
TFome clones do not contain stop codon at 3'end.
translation: MALREIESTLPPGFRFYPSDEELVCHYLHKKVANERIAQGTLVEVDLHAREPWELPEVAKLTATEWYFFSFRDRKYATGSRTNRATRTGYWKATGKDREVRSSSSATAVVVGMRKTLVFYRGRAPNGVKSGWVMHEFRLDTPHSPPREDWVLCRVFQKTKAADGDGDGGAQDGDSSSPPAAFTGPSRPRAVSEPPDHSAPPAGGGYYYGLAFGPRQVEVAQQQCYGGGGATVADHHHGFTRDSGGAAGFGATWGGGVAGGECGAGYLDMDGAFDVMMAGCFGGGDMDEFPQVWR