Tfome Clone Information

TFome Information for pUT3342

TFome Name pUT3342
Template EE030838
Genbank Insert ID JX469982
Protein Name ZmGLK40
Species Maize
TF Family G2-like
Gene ID GRMZM2G056400
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: UT2961up 3' Primer Name: UT2961dn
5' Primer Tm (º C): 61.6 3' Primer Tm (º C):
5' Primer Sequence: caccATGGAGGCGCGGGCAGC 3' Primer Sequence: TTCTGCACCATTCCAGTTTGGCC
PCR Condition: Step 1, 98°C 30 sec melt, 1 cycle; Step 2, 98&
Nucleotide Sequence: ATGGAGGCGCGGGCAGCGTCGGTCCCGGACCTTTCGCTGCACATCAGCCTTCCGAGCAGCGCCGCGTCTCCGTCTCCCGCCCCGGGGCTGGGCGCTGGAGGAGTAGGGCGTGGTGCGCAGCCGTCCGGAGGGGACCCGTGGCGCCGTCTGAACGGATCCACGGCGTCGACCGAGCTGTCGCTCTCGCCGCCGCCGCCGCGGCAGGAGGCGGCTGCCGGGGACGTCCTTCCATGGCGGCTCCGGCCGCCAGCGGCGAATTACTCCTCGTCCACCGCGGAGGCAACGTTCTTGCCGGTGACCGTGCCGCGGCTTTCGTTCGACGCCGCGGCGGAGGCGGCGCCGGCAAGGCCAATCAACGGAGTGCCCGTCTACAGCAGCCCGCGGACCGGCGCCGCCCATCCTTTTCTTGGCGCCGGCGGCGAATACCGGCAGTGCCACCACCACAAGGCCGCCGTGGGGCTATACAATCCCTACCACTCCTCGTCGTCGTGGCCCTCGTCCCTGCGGTCGACGACGACGGCGCCCCTTGGCGCCGTGGCGCCGCCGGCGTCCGACCCCACGGCGTCGTCGTACCTCTCGCCGTCCGCGTACCACCGGATGCTGTCGAGCACCGGCCGGCTCCACCTCCAGGGCGTGCTCGCCGACACGCTCCGCGGCTACGGCAGCGGGCACCACCACCGCCAGCACTTGGGCAGCCTGGCCGCGGCCCGCTACATGCCGAGGCTCCCGGCTTCCCGGCGCGGCATGCGCGCGCCGCGGATGCGGTGGACGAGCAGCCTGCACGCGCGTTTCGTCCACGCCGTCGAGCTCCTCGGCGGCCACGAGCGGGCGACGCCCAAGTCGGTGCTGGAGCTGATGGACGTGAAGGATCTGACGCTAGCGCATGTGAAGAGTCATTTGCAGATGTATAGGACCGTGAAGAGCACTGATAAGCCGCCTGCAGCAACCTCATCAGGAGGGGGAGGGCCGCCTGTGGACGGTGGTGGCGGGTCCGGCGACGACGACCACCCGAGCGATTGGCGGCGGGCTCCATCCTCATCAGCTGGTCGGGACGTCAGCCCGCAGGCGTTCACTGGACACCGGTCAGCCTCCTCGGACGGCGCGGCAAGCCATGCGGGCGGCGACGTTGAATGCTCCTCCGCCGACGATTCCGACGGTGGCAGGCCGCGCAGTGCTTCTCCGCCAAGGCTGCCGCCACCAAGTGCGTGCAATGCAGCAGACACCCTTCATTCAGTTGGCGTACCATATTCCACTACTGAGGATATGGAGCCTGCTTGTCGATCAGCTGGCTTACAACATTCACTCAACCATGAAATGAGCTGCCCTCCTAGCCTGGAGTTCACGCTAGGGCGGCCAAACTGGAATGGTGCAGAA
TFome clones do not contain stop codon at 3'end.
translation: MEARAASVPDLSLHISLPSSAASPSPAPGLGAGGVGRGAQPSGGDPWRRLNGSTASTELSLSPPPPRQEAAAGDVLPWRLRPPAANYSSSTAEATFLPVTVPRLSFDAAAEAAPARPINGVPVYSSPRTGAAHPFLGAGGEYRQCHHHKAAVGLYNPYHSSSSWPSSLRSTTTAPLGAVAPPASDPTASSYLSPSAYHRMLSSTGRLHLQGVLADTLRGYGSGHHHRQHLGSLAAARYMPRLPASRRGMRAPRMRWTSSLHARFVHAVELLGGHERATPKSVLELMDVKDLTLAHVKSHLQMYRTVKSTDKPPAATSSGGGGPPVDGGGGSGDDDHPSDWRRAPSSSAGRDVSPQAFTGHRSASSDGAASHAGGDVECSSADDSDGGRPRSASPPRLPPPSACNAADTLHSVGVPYSTTEDMEPACRSAGLQHSLNHEMSCPPSLEFTLGRPNWNGAE