Tfome Clone Information

TFome Information for pUT4005

TFome Name pUT4005
Template Genomic DNA
Genbank Insert ID KJ727024
Protein Name ZmNAC34
Species Maize
TF Family NAC
Gene ID AC208663.3_FG002
transcript T002
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: 3' Primer Name:
5' Primer Tm (º C): 3' Primer Tm (º C):
5' Primer Sequence: 3' Primer Sequence:
PCR Condition:
Nucleotide Sequence: ATGTCACCCAAGAAACCGGCGGCGCCGGGAGCCACTGATCCGGCCGCGTACACCAGCCCCCGCGACGAGGACACCAACGACGGCTGGGTGCTCGTCACCGCCGGCGTGGGCAGGCCGCCGAGGCCACCGCCGCGGCGCGGTAACAGCCCGGACGACCTCGTCGGGCGGTACCTGCCCGCGCGCCGCGCCCTGCGGTGGAGCGAGCTGCCGCCGCAGATCCACGACGCCGACGTCTACGGCGCTCACCCGGCGTTCCTCGCCAAGGTCCACCCGCCCGCCAACGGCGGCGACCGGCTCGAGTGGTTCTTCTTCGTCTGCCGCGGGCGAGGCCTCGGCGGCAAGCGGAGGGCGGGGCGCGGCGCGTACCGCCTCGTCGGCGAGGCCAAGCCCGTTGCCGCGTGGTACTGCCACTCCTTCCGCTACTACGAGGACGCGGCGGAGGCCAGTGCCTCCAGGGAGACCGGGTGGCGCATGGACGAGTACGGCGACCGCAGCGACGTCTCCGGCGCCGGGGCTTTCGACATGGTCGTTTGCAAGGTGTACCCAGCTCGCGGCGGGGTGCTGCACAGGAGACTCGTCCAGCACAGCACGACGCCCGCGGAGAAACGCGCGGTCGTGCCGGTGAAGCCGCAGGTGCTCGTGCAGCTGTACCTCGCCAGTCGCAGCGTCGGGGACCCGCTGCGGTGCCGCATGCACCACGCCACCGACGTATGCGCCGACCACCCCGCGGTGCTGACGGCCGTGCTCCCGCCGGCAAACGACAGGTTCGAGTGGTTCTTCGTCGTGCGGCGCCCGCGAACGAAGCACGGCGACGATGCCATTATTGGGTTCCCGCGAAGAGCTGGGCCGGGGCAGTACGTGCCGGCGACGCGCTATTGGTGCGTCAAGGACGGAGAAGGCCGGAACATGGGATACCTGCTCGTGTTCCTGTATCGGGAGGACGACGAGGCGACGCGGAGATTGTCGCGGGCGGAGAAGTGGTGGATGGAGGAATACGGCTTCGGGCCAGACTTCCCGTACGACGACAACGACAACGACGTCGAGGAGTTGGTCGTTTTCAAGGTGCACCTCAGAATGACCCGGCGG
TFome clones do not contain stop codon at 3'end.
translation: MSPKKPAAPGATDPAAYTSPRDEDTNDGWVLVTAGVGRPPRPPPRRGNSPDDLVGRYLPARRALRWSELPPQIHDADVYGAHPAFLAKVHPPANGGDRLEWFFFVCRGRGLGGKRRAGRGAYRLVGEAKPVAAWYCHSFRYYEDAAEASASRETGWRMDEYGDRSDVSGAGAFDMVVCKVYPARGGVLHRRLVQHSTTPAEKRAVVPVKPQVLVQLYLASRSVGDPLRCRMHHATDVCADHPAVLTAVLPPANDRFEWFFVVRRPRTKHGDDAIIGFPRRAGPGQYVPATRYWCVKDGEGRNMGYLLVFLYREDDEATRRLSRAEKWWMEEYGFGPDFPYDDNDNDVEELVVFKVHLRMTRR