Tfome Clone Information

TFome Information for pUT4119

TFome Name pUT4119
Template Synthesized template
Genbank Insert ID KJ727063
Protein Name ZmNAC55
Species Maize
TF Family NAC
Gene ID GRMZM2G152543
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: 3' Primer Name:
5' Primer Tm (º C): 3' Primer Tm (º C):
5' Primer Sequence: 3' Primer Sequence:
PCR Condition:
Nucleotide Sequence: ATGGAGGAGAGGAACGGCACCAACATGGAGAAGTCCGACGAGATCCTGATGCCGGGCTTCAGGTTCCACCCAACCGATGAGGAGCTGGTGAGCTTCTACCTGAAGAGGAAGGTGCAGCAGAAGCCGATCTCCATCGAGCTGATCAGGCAGCTGGACATCTACAAGTACGACCCGTGGGACCTGCCAAAGCTGGCTTCTACTGGCGAGAAGGAGTGGTACTTCTACTGCCCGAGGGACCGCAAGTACCGCAACTCTGTTAGGCCGAACAGGGTGACCGCTGCCGGCTTCTGGAAGGCTACTGGCACTGACAGGCCGATCTACAGCTCTGAGGGCACTAAGTGCGTGGGCCTGAAGAAGTCCCTGGTTTTCTACAAGGGCAGGGCCGCCAGGGGCATGAAGACCGATTGGATGATGCACGAGTTCAGGCTGCCAAGCCTGGCTGACCCATCTCTGCCAAAGAGGCCGATCGACAAGACCATCCCGCTGAACGACAGCTGGACCATCTGCAGGATCTTCAAGAAGACCAGCAGCCTGGCCCAGAGGGCTCTGTCTCATACTTGGGGCCCACCACTGCTTGGCGCTACCGAGGCTGACGACATGATCAACGCTCTGCAGTCTGTGCAGGCCAGCGAGTTCGCTCTCGAGTCATCTCTGCAAGTGGCCCCAGCAGCACCAGCTGCTGGCCAATTCTCTTCTAGGCACGGCCTGCATGTGCACGGCCAGCATCAACAGAAGAAGGGCACCAACAGCCCAAGCCTGGACGGCTCTAGCAGCTGCAAGCTGATCAACTTCACCAGCAGCAGCCCAAGCGAGGAGGGCAGGCCTCAGTCTCTGTCTTTCCCAGTGACCTTCCCGTTCGAGGTGCAGGGCACCCATAAGACTGCTGCTGCTGCCCCAGTTTTCTTCGGCGCTCACCCAGATCATCACCTGGGCGGCTTCGTGGTGGACTCTTCTGCTGATGTTAACGGCGGCATCGTTGGCGGCAGGTCCCAGGATTCTAGCACTAGGAAGCCGAGCAACAACGGCTTCAGCACCTCTTCTGGCGACTGGGAGACTGCTGGCAGGGTGAGCTTCCCATTCGATCTGGGCGCTGACTCTTCTGAGGAGTGGCGCTGCAACATCCCATGGGAGTCTCTGCTGACTCCAGCCGCTGTTCAGGCTGAGCTGCTTCCACAT
TFome clones do not contain stop codon at 3'end.
translation: MEERNGTNMEKSDEILMPGFRFHPTDEELVSFYLKRKVQQKPISIELIRQLDIYKYDPWDLPKLASTGEKEWYFYCPRDRKYRNSVRPNRVTAAGFWKATGTDRPIYSSEGTKCVGLKKSLVFYKGRAARGMKTDWMMHEFRLPSLADPSLPKRPIDKTIPLNDSWTICRIFKKTSSLAQRALSHTWGPPLLGATEADDMINALQSVQASEFALESSLQVAPAAPAAGQFSSRHGLHVHGQHQQKKGTNSPSLDGSSSCKLINFTSSSPSEEGRPQSLSFPVTFPFEVQGTHKTAAAAPVFFGAHPDHHLGGFVVDSSADVNGGIVGGRSQDSSTRKPSNNGFSTSSGDWETAGRVSFPFDLGADSSEEWRCNIPWESLLTPAAVQAELLPH