Tfome Clone Information

TFome Information for pUT5884

TFome Name pUT5884
Template RT-PCR
Genbank Insert ID KJ727840
Protein Name ZmTUB4
Species Maize
TF Family TUB
Gene ID GRMZM2G108228
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: R149F 3' Primer Name: R149R
5' Primer Tm (º C): 61.1 3' Primer Tm (º C):
5' Primer Sequence: caccATGAAGATGAAAACGGCAGTAAACAGG 3' Primer Sequence: TTCACAGGCCAGCTTGGTGTCG
PCR Condition:
Nucleotide Sequence: ATGAAGATGAAAACGGCAGTAAACAGGGGCCAGACCGCACAAAGGAAGGAAGGAAGGCGGTTTTTTCGGACGTGGCGTGTCCACTCATCTTCTCACCTCTTTCTTCACGCTGTTTTGTCCTCTCCTCGCCTCGCCCGGCCCCATCCATCTCGGCATCTCGCTCGTCGTCCTCCTCTCCCCTCCATAAAATCCGATCGGCAGCTCCTGGCCGCTGCCCACTCCTCCCCGCTCTGGCTCTTCCTCGCGCCTCGCGCGCCCACCCACCTTCACGCGCTCTCCCAGCTAGATCGACCCCACTGGCAATCGCGCAGGCTCCCCTATCCCTTCCTGTTCCTTCAAAAAGACTGGACTGGATCTTCCCAGAGTTCCCGTTCGGAGAGCCGCCGGATCTTCTTCGACGAGGCTTCGATCTGCTGCTCTCCGTCGGCGTGTTGGGGACTTGCACCTTATCCGAAGATGTCTTTTCGGAGCATGGTTCGTGATATAAGGGAAAGTTTTGGGAATATATCGAGGCGGAACTTTGAGGTGAGAATTCACCACAGAGGGAAGTCTCTTGGGTCTTCAGGTGACTTGCAAGACAGGCCTGCTGAAGTTCAGCAAAGCAGGTGGGCTAGCCTTCCTCCTGAGTTGCTCTGCGATGTGATGAAAAGGTTGGAGGAAGATGACAGTAGCTGGCCGGATCGCAAGGATGTTGTTTCCTGTGCATCTGTTTGTACAACCTGGAGGGATATGTGTAAGGATATTGTTAGAAGTCCAGAACATTGTGCAAAGCTCACATTTCCAGTATCTCTTAAGCAGCCTGGACCCCGAGACGGGGTAATCCAATGTTTCATAAAAAGGGACAAATCAAAGCTAACGTACCGGCTCTACTTGTCCCTTAGCTCTGGTGTGCTTGATGAGAACGGGAAGTTCCTGCTAGCAGCGAAAAGGAGCCGCAGGATGGCGCACACGGAGTATGCAATTTTTATGGACTCGAGGAATTTCTCCCGATCGAGCACTGGCTACATTGGGAAGCTAAGGTCAAATTTCCTTGGAACTAAATTTATCATCTACGACACACAGGCTCCGTACAATGGCGGGAGAGTTTGCACACAGGAACGTGCCCCCAGCCGTCGGTTGTCTTCCAGGAAAGTTTCACCAAGAGTTCCAAGCGGCAGCTACCCCGTCGCTCAGGTGAACTACGAGCTGAATGTGCTGGGAACCCGAGGGCCCAGGCGGATGCAGTGCGCTATGCATTCCATCCCCGCATCAGCGGTGGAGCCCGGCGGCGTGGTGCCTGGGCAACCGAAAGAGCTCCTCCCGAGGCTGTTCGACGAGTCCTTCCGCAGCACCGCAACTTCCTCTTTCTCCAAGTACTCCGTCGCGGACAGCTCCATGGACCTGGGCAGCTGCCCGTTCTCCGAGGTCGAGGTGGGCGGGGGAAGTCTGCGAGAAGGTGACGAGTCGGAGAAGGAGAGGCCACTGGTTCTGCGCAACAAGGCGCCGAGGTGGCACGAGCAGCTGCAGTGCTGGTGCCTCAACTTTCGCGGGCGCGTCACCGTGGCCTCGGTCAAGAACTTCCAGCTGATAGCTCCTGCAAAGACGCAGCCGCAGCCGCAGGCCTCCGGCCCCCCGCCGCCGCCGCCGCCGTCGTCGTCGTCGTACCATGACCCGGTGATCCTGCAGTTCGGCAAGGTCGGGAGGGACATGTTCACCATGGACTACCGGTACCCGCTGTCGGCCTTCCAGGCCTTCGCCATATGTCTGACGAGCTTCGACACCAAGCTGGCCTGTGAA
TFome clones do not contain stop codon at 3'end.
translation: MKMKTAVNRGQTAQRKEGRRFFRTWRVHSSSHLFLHAVLSSPRLARPHPSRHLARRPPLPSIKSDRQLLAAAHSSPLWLFLAPRAPTHLHALSQLDRPHWQSRRLPYPFLFLQKDWTGSSQSSRSESRRIFFDEASICCSPSACWGLAPYPKMSFRSMVRDIRESFGNISRRNFEVRIHHRGKSLGSSGDLQDRPAEVQQSRWASLPPELLCDVMKRLEEDDSSWPDRKDVVSCASVCTTWRDMCKDIVRSPEHCAKLTFPVSLKQPGPRDGVIQCFIKRDKSKLTYRLYLSLSSGVLDENGKFLLAAKRSRRMAHTEYAIFMDSRNFSRSSTGYIGKLRSNFLGTKFIIYDTQAPYNGGRVCTQERAPSRRLSSRKVSPRVPSGSYPVAQVNYELNVLGTRGPRRMQCAMHSIPASAVEPGGVVPGQPKELLPRLFDESFRSTATSSFSKYSVADSSMDLGSCPFSEVEVGGGSLREGDESEKERPLVLRNKAPRWHEQLQCWCLNFRGRVTVASVKNFQLIAPAKTQPQPQASGPPPPPPPSSSSYHDPVILQFGKVGRDMFTMDYRYPLSAFQAFAICLTSFDTKLACE