Tfome Clone Information

TFome Information for pUT1147

TFome Name pUT1147
Template AM156904
Genbank Insert ID HQ858691
Protein Name ZmMYB9
Species Maize
TF Family MYB
Gene ID GRMZM2G081557
transcript T01
Vector pENTR/D-TOPO
Note c.Start+120
Request Information: Deposited to ABRC
5' Primer Name: D1 UP 3' Primer Name: D1 DN
5' Primer Tm (º C): 63.0 3' Primer Tm (º C):
5' Primer Sequence: CAC CAT GGG GAG GTC CCC G 3' Primer Sequence: TAGTGGCAGGCTGAAGCTgc
PCR Condition: Step 1, 98C 30 sec melt, 1 cycle; Step 2, 98C 10 s
Nucleotide Sequence: ATGGGGAGGTCCCCGTGCTGCTGCCACGACGCCGGCGTCAAGAAAGGCCCGTGGACGGAGGAGGAGGACCGCGCCCTGGTGGACCACATCCAGAGGCACGGCGGCCACGTCAGCAGCTGGCGCAACCTGCCCAAGGCCGCCGGGCTCAACCGCTGCGGCAAGAGCTGCCGCCTCCGCTGGACCAACTACCTCCGCCCCGACATCAAGCGCGGCAACTTCACCGACGACGAGGAGCGCCTCATCATCGGCCTCCATGCCCAGCTCGGTAACAGGTGGTCGACGATCGCGACGCACCTGGACGGGCGGACGGACAACGAGATCAAGAACTACTGGAACACGCACATCCGCAAGAAGCTGCTGCGCATGGGCGTCGACCCCGTCACGCACCAGCGCCTGCCCCCCGACGACCTGCTGCTCGCCGTCTCCGCCTCCCCCACGACGACGATCCTCTCGGCGGCGGCGAGCCAGCTGCGGGGCCTGAACACCGCTCTCATGCAGGTGCAAGCGCTGCAGTTTCTGCTGCAGGCCGTCAGTGGAGTTGGAAACGACGTTAACGCCGCCGCCGCTGCTGCTAATGGTGGTGGTGGTCTCGTCCCTAGCCTCAGCGCAGCCGCAGATAATAACGCCGTTCTGAACGCGAGCCGTAGCGTCGTTCCAGGCTTCCAGGACCTGCAGCTGACGACGATGACCAGGCCTCTTCTCGTGTCTCACGCGAATCACGGGTCAGCTGATCATCATCCCAGCTACATCGCAACTGATGATGTGGTGCAGCGACGACTGAACGCTTCGGCTCCTCCGGTGGTCGGCGGCGGCGCCTGTGCAGAGCCGCTGGCTGTTGCATTGGCGTCCACGGCTTATCGACACCAAGTGGCAGCTGCCGCTGACGAGCCGGTGAATGGTTTTGCCGAGCTAATACTGTCGGAGCCCATCGAGATGCCGAGCATGTGCTCTCTGGAGGACGAAGATCATTTCTGGAAGGACATGCTCGTAGAGAGCAGCAGCTTCAGCCTGCCACTA
TFome clones do not contain stop codon at 3'end.
translation: MGRSPCCCHDAGVKKGPWTEEEDRALVDHIQRHGGHVSSWRNLPKAAGLNRCGKSCRLRWTNYLRPDIKRGNFTDDEERLIIGLHAQLGNRWSTIATHLDGRTDNEIKNYWNTHIRKKLLRMGVDPVTHQRLPPDDLLLAVSASPTTTILSAAASQLRGLNTALMQVQALQFLLQAVSGVGNDVNAAAAAANGGGGLVPSLSAAADNNAVLNASRSVVPGFQDLQLTTMTRPLLVSHANHGSADHHPSYIATDDVVQRRLNASAPPVVGGGACAEPLAVALASTAYRHQVAAAADEPVNGFAELILSEPIEMPSMCSLEDEDHFWKDMLVESSSFSLPL