Tfome Clone Information

TFome Information for pUT1149

TFome Name pUT1149
Template AM156907
Genbank Insert ID HQ858693
Protein Name ZmMYB39
Species Maize
TF Family MYB
Gene ID GRMZM2G127857
transcript T01
Vector pENTR/D-TOPO
Note c.G6C p.(=); PZE04141737314 c.C80T p.A27V; c.C352G p.P118A; PZE04141737942 c.A355C p.K119Q; PZE04141737945 c.A453G p.(=); PZE04141738043 c.G469T p.A157S; c.G501A p.(=); PZE04141738091 c.C529G p.P177A; PZE04141738119 c.G554A p.G185D; PZE04141738144 c.C567A p.(=); PZE04141738157 c.C621G p.(=); PZE04141738211 c.A682G c.A683C p.K228A; c.408del12. Clone is from inbred line W64, obtained from David Capparos. Present in template FlcDNA.
Request Information: Deposited to ABRC
5' Primer Name: D3 UP 3' Primer Name: D3 DN
5' Primer Tm (º C): 61.6 3' Primer Tm (º C):
5' Primer Sequence: CAC CAT GGG CCG CTC TCC 3' Primer Sequence: AATAATCTGGGGCAAATTctgc
PCR Condition: Step 1, 98C 30 sec melt, 1 cycle; Step 2, 98C 10 s
Nucleotide Sequence: ATGGGCCGCTCTCCGTGCTGCGAGAAGATGGGGCTGAAGAGGGGTCCGTGGACGGCCGAGGAGGACAGGATTCTGGTGGTGCACGTCGAGCGCCACGGCCACAGCAACTGGCGCGCGCTGCCCAAGCAGGCGGGCCTGCTCCGCTGCGGCAAGAGCTGCCGCCTCCGCTGGATCAACTACCTGCGCCCCGACATCAAGCGCGGCAACTTCAGCCGGGAGGAGGAGGACGCCATCATACAGCTCCACCAAATGCTCGGCAACAGATGGTCGACAATCGCTGCCAGGCTGCCGGGGAGGACGGACAACGAGATCAAGAACGTCTGGCACACCCACCTCAAGAAGCGCCTGGAGGCACAGCCAGCCAGCCAGCAGGCGCCCAAGCGCAAGCCCACGAAGAAGCAGCAGCCCGAGCCCGTAACGACGCTCGAGGGGCCGGCCGGGGCCGTGCCGCCGGTGTCGCCGGAGCGGTCACTCTCCACGACGACGTCAACCACCACCAGCACCGCGGACTACTCGGCCGCCTCGTCGCTGGAGAACGCGGACGACAGCTTCACATCGGAGGAGGACTACTACCAGATCGACGACAGCTTCTGGTCCGAGACGCTGGCGATGACGACGACGGTGGACAGCTTCGAGTCCGGGGTGCAGCAGGCGGAGGGCAGCTTCGGCGCGTCGGCGGCGGCGCCGTCGTCGACCAACGACGACATGGACTTCTGGCTCAAGCTGTTCATGCAGGCCAGCGACATGCAGAATTTGCCCCAGATTATT
TFome clones do not contain stop codon at 3'end.
translation: MGRSPCCEKMGLKRGPWTAEEDRILVVHVERHGHSNWRALPKQAGLLRCGKSCRLRWINYLRPDIKRGNFSREEEDAIIQLHQMLGNRWSTIAARLPGRTDNEIKNVWHTHLKKRLEAQPASQQAPKRKPTKKQQPEPVTTLEGPAGAVPPVSPERSLSTTTSTTTSTADYSAASSLENADDSFTSEEDYYQIDDSFWSETLAMTTTVDSFESGVQQAEGSFGASAAAPSSTNDDMDFWLKLFMQASDMQNLPQII