Tfome Clone Information

TFome Information for pUT1170

TFome Name pUT1170
Template EB637416
Genbank Insert ID HQ858714
Protein Name ZmMYB26
Species Maize
TF Family MYB
Gene ID GRMZM2G170049
transcript T01
Vector pENTR/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: B55 UP 3' Primer Name: B55 DN
5' Primer Tm (º C): 62.0 3' Primer Tm (º C):
5' Primer Sequence: CAC CAT GGG GTG CAA GGC G 3' Primer Sequence: GTCGAGGCCGAAGTAGTCgc
PCR Condition: Step 1, 98C 30 sec melt, 1 cycle; Step 2, 98C 10 s
Nucleotide Sequence: ATGGGGTGCAAGGCGTGCGACAAGCCCAAGCCCAACTACCGCAAGGGCCTGTGGTCGCCGGAGGAGGACCAGAAGCTCCGCGACTACATTCTCCTCCACGGCCACGGCTGCTGGAGCGCGCTCCCCGCGAAAGCCGGGCTCCAGCGGAACGGCAAGAGCTGCAGGCTGCGGTGGATCAACTACCTTCGGCCGGGGCTGAAGCACGGCATGTTCTCCCCGGAGGAGGAGGAGACGGTGATGAGCCTCCACGCCACGCTCGGCAACAAGTGGTCCAGGATCGCACGGCACTTGCCTGGCAGGACCGACAACGAGGTCAAGAACTACTGGAACTCGTACCTCAAGAAGAGGGTCGAGGGCAAGGACCAGGGGCCCAGCACGCCCGCGCCGGCGGCGTCCAATTCGGACGACGACTCGCACTGCGTCAAGCAGCGCAGGGACGACGACGGCACGGCGGACTCCGGCGCGTCGGAGCCGCGCGAGTCGTCGTCGGCCGACGACTCGAGCTGCCTGACGGACCCGCACGCCTGCAGGCCCCACGCGCCCGTGCCGCCCAAGGTCATGTTCGCGGACTGGCTGGACATGGACTACGTGGGCGGTGCCCTGCCGGCGACAGCACCAGCAGCACCTGGTCTGCTCGGCGCTGCGGGCGTGGCCACGGCCAGCACGGGCGACCGCGATCAGCATCAGGTGATGAGCATGAGCCAGGGGTCCGTTCAGGTGGATGGGCCATCCGGTGCCGATGTGTCCCTGCACGGCTTCGATGACAGCGGCGCCGGCTGCTGGGAGTTCCAGGAGCACTTCGATGCCATCGATCACATGCAGGCGGCCGGCTTCTGCGACCTGCTCTCCATGAGCGACTACTTCGGCCTCGAC
TFome clones do not contain stop codon at 3'end.
translation: MGCKACDKPKPNYRKGLWSPEEDQKLRDYILLHGHGCWSALPAKAGLQRNGKSCRLRWINYLRPGLKHGMFSPEEEETVMSLHATLGNKWSRIARHLPGRTDNEVKNYWNSYLKKRVEGKDQGPSTPAPAASNSDDDSHCVKQRRDDDGTADSGASEPRESSSADDSSCLTDPHACRPHAPVPPKVMFADWLDMDYVGGALPATAPAAPGLLGAAGVATASTGDRDQHQVMSMSQGSVQVDGPSGADVSLHGFDDSGAGCWEFQEHFDAIDHMQAAGFCDLLSMSDYFGLD