Tfome Clone Information

TFome Information for pUT1177

TFome Name pUT1177
Template EE177923
Genbank Insert ID HQ858718
Protein Name ZmMYB27
Species Maize
TF Family MYB
Gene ID GRMZM2G064744
transcript T01
Vector pENTR/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: C18 UP 3' Primer Name: C18 DN
5' Primer Tm (º C): 65.2 3' Primer Tm (º C):
5' Primer Sequence: caccATGGGGCGCGAGGC 3' Primer Sequence: GAGGAAGTCGACGCTGAA
PCR Condition: Step 1, 98C 30 sec melt, 1 cycle; Step 2, 98C 10 s
Nucleotide Sequence: ATGGGGCGCGAGGCGGCAGCCACGAGGCCGCCCAAGCTGCGGAGGGGCCTGTGGTCGCCGGAGGAGGACGAGAAGCTGTACAATCACATCATCCGATATGGCGTCGGCTGCTGGAGCTCAGTCCCAAAGCTCGCTGGCTTGGAGAGATGCGGCAAGAGCTGCAGGCTGAGATGGATCAACTACCTGCGGCCTGACCTCAAGAGGGGCAGCTTCTCCCAGCAGGAGGAGGATCTCATCGTCAGCCTCCACAAGATACTAGGCAACAGGTGGTCCCAGATCGCGTCGCAGCTGCCGGGGAGGACGGACAACGAGATCAAAAACTTCTGGAACTCGTGCATCAAGAAGAAGCTCCGGCAGCAGGGCATCGACCCCGCCACCCACAAGCCGCTCAACGACGACGACAACGCTGCTGCTGCTGCTGCTGCGGACAACGACGCCGCCGTGGCGCCGCACCACCATCGTCGTCATCAGGACGACCACTGCGGCGCCGCCAATATTGATAATAATAATAATAACAACAACAACAACAACAATCGGCAGCTCCCCTCAGCCGACGACCACTGCTTCGCCATGAGCAGCGACGACCCTCTCGCGCCACACTCCCCGACCGTCAGCTTCGACCCACTGTCCGTCACCAACGTCCCCACGGCAATGCAGCAGGGCTCCTACGGCTCGTTCCGCTCCGACAACGACCACCTCTGCGACTACGGCGGCGGCGGCGTCGACGTGGTCTCGGACGCCGCCACGGCGTACAGCGCCCCCTACACAGGCGGCGGCGGCGGCGGCGGAGACAGCTCCAGCAACAGCAACGGCAACGGCACCTGGGCCTGCAGCGGCGGCGAGCCGATGCCGCCGCACGTGGCCATGTTCGGCCGCGATGCTGCCCAGGCGGCGGCGTACCATCAGTTCGTCGACCCGGCCAAGTACAGCCCCTGGCAGCAGCACCCGGCGGCGAGGCTCCATGATCACAACGTCGGCGGCGCTGCTGCGGGCTTCCCGATACGGTCCATGTCGCGGGACCTGCCGGGTTCCTGCTTCGACCTCGCCCGCAGCGCGCTGGAGGACGAGTTCAGCGTCGACTTCCTC
TFome clones do not contain stop codon at 3'end.
translation: MGREAAATRPPKLRRGLWSPEEDEKLYNHIIRYGVGCWSSVPKLAGLERCGKSCRLRWINYLRPDLKRGSFSQQEEDLIVSLHKILGNRWSQIASQLPGRTDNEIKNFWNSCIKKKLRQQGIDPATHKPLNDDDNAAAAAAADNDAAVAPHHHRRHQDDHCGAANIDNNNNNNNNNNNRQLPSADDHCFAMSSDDPLAPHSPTVSFDPLSVTNVPTAMQQGSYGSFRSDNDHLCDYGGGGVDVVSDAATAYSAPYTGGGGGGGDSSSNSNGNGTWACSGGEPMPPHVAMFGRDAAQAAAYHQFVDPAKYSPWQQHPAARLHDHNVGGAAAGFPIRSMSRDLPGSCFDLARSALEDEFSVDFL