Tfome Clone Information

TFome Information for pUT1180

TFome Name pUT1180
Template
Genbank Insert ID HQ858802
Protein Name OsCOL11
Species Rice
TF Family C2C2-CO-like
Gene ID LOC_Os06g19444
transcript
Vector
Note
Request Information: Deposited to ABRC
5' Primer Name: 3' Primer Name:
5' Primer Tm (º C): 0.0 3' Primer Tm (º C): 0.0
5' Primer Sequence: 3' Primer Sequence:
PCR Condition:
Nucleotide Sequence: ATGGGCGCTCTTTGTGATTTCTGCGGGGAGCAGAGGTCTATGGTTTATTGCCGATCAGATGCAGCATCCTTGTGCTTATCGTGTGACCGTAATGTGCATTCAGCTAATGCTCTTTCTCGGCGCCATACAAGGACACTTCTGTGTGATAGATGTGCTTCACAGCCTGCCATGGTCCGCTGCCTTGTAGAAAATGCCTCGCTTTGCCAAAATTGTGATTGGAATGGGCATAGTGCTGGGTCTTCAGCTGCTGGTCATAAGAGGCAGACCATAAACTGCTACTCAGGGTGCCCATCATCTTCAGAACTTTCAAAAATCTGGACATTTGTTTCGGATATTCCTAATGTAGCTCCTGAGCCGAATTGCGAGCAAGGGATAAGCATGATGAGCATCAGCGACAGTGGTGTCAGTAATCAAGACAATGCTGCAGGGGACAGCAGTTTGTTAGATATTGCTAGTGCAACCCTTATGAGTGATCTTGGCACTGCTGGCAAGCCAAAGTCTTTGATAGGCTCCTCATCTGAAGCTGGCGTGAACCTTCTTCCACTTGCTACTGATCAGATGGCTGGATCCGTGGATTCGACATCAGCTAAGGTGCCCTATACGGCAGACCAAGATATGTTCAGCAAAGACAGTATATATGAAGATTTCTGTGTGGACGATGTTGATCTTAGTTTCGAAAATTATGAGGAACTATTTGGCACCTCCCATATTCAAACAGAGCAACTGTTTGATGATGCTGGGATCGACAGTTACTTTGAATCGAAGGAAATACCTTCTGGAAACTCTGATGAGCCCAAGCTGATGCAGCCAGTGACCAGCAATGCAGTATCTGCTGATTCAGGGATGTCGATCCCAGGAGCCAAAGGTGATTCCAGTCTTTGTATACCTGTGAGGCAAGCTAGGTCCAGTATCTCTCTTTCATTTTCTGGTTTGACTGGTGAGAGCAGTGCTGGAGATTACCAAGATTGTGGGGTATCACCAGTGCTCCTTATGGGTGAGCCTCCTTGGCATCCTCCTGGCCCTGAGGGGTCATTTGCTGGAGCTACCAGAGACGATGCTATCACACGATACAAGGAGAAGAAGAAGAGAAGAAAATTTGACAAGAAAATCAGGTATGCATCTCGCAAGGCTAGGGCAGATGTGAGAAAAAGAGTCAAGGGCCGGTTTGTTAAGGCTGGTGAAGCATACGACTACGATCCACTCTGTGAAACGAGGAGCTAC
TFome clones do not contain stop codon at 3'end.
translation: mgalcdfcgeqrsmvycrsdaaslclscdrnvhsanalsrrhtrtllcdrcasqpamvrclvenaslcqncdwnghsagssaaghkrqtincysgcpssselskiwtfvsdipnvapepnceqgismmsisdsgvsnqdnaagdsslldiasatlmsdlgtagkpksligssseagvnllplatdqmagsvdstsakvpytadqdmfskdsiyedfcvddvdlsfenyeelfgtshiqteqlfddagidsyfeskeipsgnsdepklmqpvtsnavsadsgmsipgakgdsslcipvrqarssislsfsgltgessagdyqdcgvspvllmgeppwhppgpegsfagatrddaitrykekkkrrkfdkkiryasrkaradvrkrvkgrfvkageaydydplcetrsy