Tfome Clone Information

TFome Information for pUT1397

TFome Name pUT1397
Template DV507382
Genbank Insert ID HQ858729
Protein Name ZmTUB1
Species Maize
TF Family TUB
Gene ID GRMZM2G068586
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: B102 UP 3' Primer Name: B102 DN
5' Primer Tm (º C): 63.7 3' Primer Tm (º C):
5' Primer Sequence: CAC CAT GCC TCG GGA TGG CG 3' Primer Sequence: TTCACAGGCTAGCTTGGTC
PCR Condition: Step 1, 98C 30 sec melt, 1 cycle; Step 2, 98C 10 s
Nucleotide Sequence: ATGCCTCGGGATGGCGCGCAGGCGGCGCCGCCACCGGAGCGCGGCGAGATGGACGAGGTGGTAGAGGCGGACCCGGATACGGAGGCGGAGGATCAGGAGGAGAGGTGGGCGAGGCTGCTGCCGGAGCTGCTCTCCGACGTGGTGCGGCGCGTCGAGGCGTCCGGCGGCGAGCGGTGGCCGGCGCGGAAGGACGTCGTCTCCTGCGCCTGCGTGTGCCGCCGGTGGCGGGAGGCCGCCGTCTCCGTCGTGCGTCCGCCGGCGGAGTCCGGCAAGATCACCTTCCCCTCCTCGCTCAAGCAGCCAGGGCCAAGGGAGAGACCAATGCAGTGCTTTATCAAGAGGAATAAGAACAACTCTACATTCTACCTCTACCTTGGCTTCACAAGTTCACCTGTGGATAAAGGGAAGTTTCTCATGGCTGCTAGAAGATTTAGGCGTGGTCCCCATACCGAGTACATTATATCTCTTGATGCAGAAGACTTATCACAAGGGAGCAATGCATACATGGGGAAACTGAGATCTGATTTCTGGGGGACAAACTTCAAAATATATGATAGCAAGCCACCATATGATGGTGCTAAAGCATCAAGTAGTCGATCTAGTCGTCGTTTCGGAAGCAGAAGGATTAGTCCCCAGGTATCGGCTGGCAATTATGAAGTTGGACAGGTTTCATACAAATACAACTTGCTCAAATCCAGAGGCCCCAGGAGAATGTATTGCACTCTCGAATGCCCTTCAGCCCAAGAGACTTGGGAAAACTCACTCAAGACAAAGTTCAGGCGCCCCCTGGGCCCCACAACTTTACGAAATAAAGCACCCCGCTGGCATGAGCACCTGCAATGCTGGTGCTTAAACTTCCATGGGCGGGTAACAGTTGCATCAGTCAAGAATTTCCAGCTTGTGGCTGCTGCCGACCCCAGTGAGCCTACTACCAACGTGGATGATGAAACGGTTCTGCTGCAGTTTGGTAAGGTCGATAGCGATATGTTCACAATGGATTACCGGCAACCACTCTCCGCGTTTCAAGCATTTGCCATCAGCCTCAGCAGCTTTGGGACCAAGCTAGCCTGTGAA
TFome clones do not contain stop codon at 3'end.
translation: MPRDGAQAAPPPERGEMDEVVEADPDTEAEDQEERWARLLPELLSDVVRRVEASGGERWPARKDVVSCACVCRRWREAAVSVVRPPAESGKITFPSSLKQPGPRERPMQCFIKRNKNNSTFYLYLGFTSSPVDKGKFLMAARRFRRGPHTEYIISLDAEDLSQGSNAYMGKLRSDFWGTNFKIYDSKPPYDGAKASSSRSSRRFGSRRISPQVSAGNYEVGQVSYKYNLLKSRGPRRMYCTLECPSAQETWENSLKTKFRRPLGPTTLRNKAPRWHEHLQCWCLNFHGRVTVASVKNFQLVAAADPSEPTTNVDDETVLLQFGKVDSDMFTMDYRQPLSAFQAFAISLSSFGTKLACE