Tfome Clone Information

TFome Information for pUT1549

TFome Name pUT1549
Template
Genbank Insert ID HQ858845
Protein Name OsARID1
Species Rice
TF Family ARID
Gene ID LOC_Os02g27060
transcript
Vector pENTR/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: 3' Primer Name:
5' Primer Tm (º C): 70.0 3' Primer Tm (º C): 60.0
5' Primer Sequence: caccATGAGCGCGGCGGCGGA 3' Primer Sequence: ATTAGGTGGCATGTCACGTTTC
PCR Condition:
Nucleotide Sequence: ATGAGCGCGGCGGCGGAGGAGGCGGCTGCGGCGGCGGCGGCGGAGGAGGTGGAGGGGGTGGAGGCGGGGAAGAAGGGCGTGGCGGATGCGAAGGGGAAGGGGAAGGAGAAGGTGGTGGTGGCGGAGGAGGATTCTGCGGTGGCGGCGGGCTCCGGGGGAAGCGGAGGCGGGAGGAGGACGTTGGTGGCGTACCCGGCGCGGGTTGCGGGGTACAAGGACGTGGTGGCGGACGCGGCGGTCTTCAGGAGGGCGCTCGAGGGGTTGCACGCCCAGATGGGGACAAAGCTCAAGGTGCCAATTATTGGTGGAAAAGACCTTGATCTTCATCAGCTGTTTAAGGAGGTCACTTCACGAGGTGGCATTGATAAGGTGAAGTCCGATAATAGATGGAGGGAAGTAACAGCATCATTTATTTTCCCTGCTACTGCGACAAATGCTTCTTTTATGTTGAAGAAATACTACATGTCACTATTATACCATTTTGAGAGGCTATACTTGTTTGAGGCACAAGGCTGGTATCAAGAAACTGATTCCAGAAGCATTTCCTGTATAGAAATGAAAGCTGAAGGTCAAGCTTCCCGGAAAAGGAAAAGAGGAAGCAATTCTTGTTCTTCAGACCTAGCTGCTTCTTTGGATAATGATGTACAAGTGATAATTGATGGTAAGTTTGAACATGGCTACATAGTTACCGTTATCATGGGCTCAAAATCAACGAAAGCGGTACTCTATAATTGCACCGAAGAACCTGCAGTGCCAACTGCGGTGCCTCATGTTGCAATTGACAGCGCTGAGGGCATACGTCCTCGCCGCCGCCGCCGTAGGAAGAAGTTAAGTACAACAGACCCCAACCATCCTAAACCAAACAGGAGCGGCTACAATTTCTTCTTCCAAGATCAGCACAGGAAGCTCAAGCCAGAATATCCTGGACAAGACAGGCTTATCAGCAAGATGATTGGTGAACGATGGAACAATTTAGGCCCTGAAGATAAAGCAGTATATCAAGAAAAAGGTGTAGAGGACAAGGCAAGGTACCAGAGACAGTTAGCTCTTTACAGAGAACAGAGAACAGGCCAGCCAATCAGCAACGCGGTGCCTATCCAGCAGAGACTTCCTCAGAAAGAAGTGACGATTGATGAGGTGGACTCTAAAGTCAGTGAAGGTGATATCCTGCTGTCCAACCAAGGATACAGCAGCAGTACCAGTAGCAGTGATGAAACCGCTGATTCGGGAGAAAAAAATGTGGAAGATGATGAAGAGTTTAACACAGAGACATCTCCTGAGCCGAGCATGGAAACAACAGATTCTCATGGACAGCCTGATCCTTCTGCTGATGGGGAGCGCTTTGAACTGCGCCGCAGGGAGAACCCTAAGATTGATGAGAAACGTGACATGCCACCTAAT
TFome clones do not contain stop codon at 3'end.
translation: msaaaeeaaaaaaaeevegveagkkgvadakgkgkekvvvaeedsavaagsggsgggrrtlvayparvagykdvvadaavfrraleglhaqmgtklkvpiiggkdldlhqlfkevtsrggidkvksdnrwrevtasfifpatatnasfmlkkyymsllyhferlylfeaqgwyqetdsrsisciemkaegqasrkrkrgsnscssdlaasldndvqviidgkfehgyivtvimgskstkavlyncteepavptavphvaidsaegirprrrrrrkklsttdpnhpkpnrsgynfffqdqhrklkpeypgqdrliskmigerwnnlgpedkavyqekgvedkaryqrqlalyreqrtgqpisnavpiqqrlpqkevtidevdskvsegdillsnqgyssstsssdetadsgeknveddeefntetspepsmettdshgqpdpsadgerfelrrrenpkidekrdmppn