Tfome Clone Information

TFome Information for pUT1613

TFome Name pUT1613
Template
Genbank Insert ID HQ858850
Protein Name OsbHLH31
Species Rice
TF Family bHLH
Gene ID LOC_Os02g23823
transcript
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: 3' Primer Name: R213DN
5' Primer Tm (º C): 65.7 3' Primer Tm (º C): 61.1
5' Primer Sequence: caccatggatccgcgcagcagc 3' Primer Sequence: TGT CTG TAC TGT CGA TCG TTG ATC ATC AGC
PCR Condition: Step 1, 98C 30 sec melt, 1 cycle; Step 2, 98C 10 s
Nucleotide Sequence: AuGGAuCCGCGCAGCAGCCAGGCGCAAGAGGACGGCuuCuuCCACCCACGCGACGGCGCGuGCCCCGCCGACuCCAGCGGAAAGACAGAAuGuAAAACCCAGGGuuCAAuuGCCACGCGCAAGGuuCAAAAGGCuGAuCGuGAGAAAAuGCGAAGAGAuAGAuuGAAuGAGCAGuuCCAGGAACuuGGAAGCACACuuGAuCCAGAuCGACCCAGGAAuGAuAAGGCAACuAuCCuuAGuGAuGCAAuuCAAAuGCuGAAAGAuuuGACGuCCCAGGuGAACAAGCuuAAAGCuGAAuAuACuuCACuCuCAGAAGAAGCACGuGAGuuGACuCAGGAAAAGAAuGAGCuCAGAGAuGAGAAAGuuuCACuGAAGuuuGAGGuuGAuAAuCuGAAuACCCAGuAuCAGCAACGAAuGCGuGuGCuGuACCCuuGGACuGGAAuGGAGCCuuCuGuuGuCAuuGGGCCACCCCuGCCAuAuCCuuuuuCAGuCCCAGuCCCAGuCCCAGuCCCuAuACCuuCAGGuGCuGuuCCuAuGCACCCACAGCuCCAGGCAuACCCuuACuuCCGAAAuCAAACuuCuGGAACCGuCuCCAAuCCAuGCACACCuuACAuGGCAuACACuCAACCCAuCCAuCCuCCuACuGAuCAACuAuCuAACCAAuuCAGuGCuCCAGuuCAGCAuuCAAGuAGuAAuCGAuCuCACuCuAuGGCCCAAGACuCuAGAAGCAAGuCCuCuGCACuGCAGCAAGuAAGuuGuAGAGGGAAACAuGAuGACuuuGAuGACGuuGCAACuGAuCuGGAACuAAAAACuCCuGGuuCCuCAGCCCCuCuACAAuCAGAGAuuGCCAACAAGGAuuCCuCuuCuGACuuGAAAAAAAAGCAGCAGuuCAuACAGGAAACuAAAGGuAGuuCuCuuACAGAAGGCAGuAGuAGuuCAAGCAGAuGCuCGuCCAGuGGuCCuCCAGAuGuCuCuAACAGuAuuGAAGGuGGAuCAGuuGCuGAuGAuCAACGAuCGACAGuACAGACA
TFome clones do not contain stop codon at 3'end.
translation: MDPRSSQAQEDGFFHPRDGACPADSSGKTECKTQGSIATRKVQKADREKMRRDRLNEQFQELGSTLDPDRPRNDKATILSDAIQMLKDLTSQVNKLKAEYTSLSEEARELTQEKNELRDEKVSLKFEVDNLNTQYQQRMRVLYPWTGMEPSVVIGPPLPYPFSVPVPVPVPIPSGAVPMHPQLQAYPYFRNQTSGTVSNPCTPYMAYTQPIHPPTDQLSNQFSAPVQHSSSNRSHSMAQDSRSKSSALQQVSCRGKHDDFDDVATDLELKTPGSSAPLQSEIANKDSSSDLKKKQQFIQETKGSSLTEGSSSSSRCSSSGPPDVSNSIEGGSVADDQRSTVQT