Tfome Clone Information

TFome Information for pUT1663

TFome Name pUT1663
Template EB402539
Genbank Insert ID HQ858763
Protein Name ZmMYB36
Species Maize
TF Family MYB
Gene ID GRMZM2G169316
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: B56 UP 3' Primer Name: B56 DN
5' Primer Tm (º C): 64.0 3' Primer Tm (º C):
5' Primer Sequence: CAC CAT GTC GGC CGC CGA AAC 3' Primer Sequence: GGT TGG TGG AAT TGA TTG CAT CAA GT
PCR Condition: Step 1, 98C 30 sec melt, 1 cycle; Step 2, 98C 10 s
Nucleotide Sequence: ATGTCGGCCGCCGAAACCGCTGTTTCTCCGACGACGACGCCGCAGCCGCAGCTGCAATCGGATCCGAACGCCGCCGCCGACGCGGCCAGTTCCAATTCTCTCTGGGTGGCCGACGAGACGCAAACCCTAACCGAGGTCCTGCTCCAACCCCAACCAAACCACCTGTCGCCTCCTCCTTCTGGTGAAGGGGACGACGGGATCACTGCCTCCGGTGCTCCTGTTGGTGGGGACGCCGCGGCATCTGCTTCTGCTGCGGCGGCGGCTAACGCGACGATAGAAGAGCGGGTGAGGGGGCCGTGGTCCCCAGAGGAGGACGCGGTGCTGAGCAACCTCGTGGAGAAGTTCGGGGCGCGGAACTGGACGCTGATCGCGCGTGGCATCCCGGGCCGCTCCGGCAAGTCCTGCCGCCTGCGCTGGTGCAATCAGCTCGACCCCCAAGTCAAGCGCAAGCCTTTCACTGAAGAGGAGGACCGCATTATAATGGCAGCTCATGCTGTCCATGGGAACAAGTGGGCATCTATCGCAAAGCTTTTGGATGGGAGAACAGACAATGCCATCAAGAATCACTGGAATTCCACCCTGAGGCGTCGCTACTGCAATGATGGCCAATGCAAGCATGGTGGTTCTGTGGAGCGAAGTATCCCAAAGGTGTCCAGGGAAGTTTCAGAAGAACCTTGGCCTTTAAACGATCTTAATTCCTTCACCGCTATGGATGTAAAGGATGATCCTGTGCAAACAGCTCCAGATACTTCTCCTCGGGCAAGGCACATCACAGATCATTGTTCTATTACTCAAGTCGTTGATCCACCATACCTGTCCCGACCAGCGGCAAAGATTGGTGCTTTCAGACCATATTATCTAGGACACACGGAACCTACCCAACAAGAAATGCCAGGTGCTGTCGTCATGTTTGACTCAACTCATAAAGTCTCGACTCCTGAAAGCGAGGTATTCAAGTTTGTTGATCCTATATGCTTTGCTGCTGAGGTGCCAGACAAATGTGGGTATGGTTGCTGCGGTGCTCATGAGCAGCATCGTAAGAACTCATTGCTGGGTCCTGAGTTCAGTGAGTTTGAAGGTCATCCACCTGTTTTAAATATTAGCTTTGCTTCATTGGTATCAGAAATTAGCAGCATTGCCTGGATGAGAAGTGGTATGCAAAGCAGTGATTCCAGCAACTTGATGCAATCAATTCCACCAACC
TFome clones do not contain stop codon at 3'end.
translation: MSAAETAVSPTTTPQPQLQSDPNAAADAASSNSLWVADETQTLTEVLLQPQPNHLSPPPSGEGDDGITASGAPVGGDAAASASAAAAANATIEERVRGPWSPEEDAVLSNLVEKFGARNWTLIARGIPGRSGKSCRLRWCNQLDPQVKRKPFTEEEDRIIMAAHAVHGNKWASIAKLLDGRTDNAIKNHWNSTLRRRYCNDGQCKHGGSVERSIPKVSREVSEEPWPLNDLNSFTAMDVKDDPVQTAPDTSPRARHITDHCSITQVVDPPYLSRPAAKIGAFRPYYLGHTEPTQQEMPGAVVMFDSTHKVSTPESEVFKFVDPICFAAEVPDKCGYGCCGAHEQHRKNSLLGPEFSEFEGHPPVLNISFASLVSEISSIAWMRSGMQSSDSSNLMQSIPPT