Tfome Clone Information

TFome Information for pUT1669

TFome Name pUT1669
Template
Genbank Insert ID HQ858860
Protein Name OsWRKY62
Species Rice
TF Family WRKY
Gene ID LOC_Os05g49620
transcript
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: 3' Primer Name: R238DN
5' Primer Tm (º C): 61.0 3' Primer Tm (º C): 57.6
5' Primer Sequence: caccatggtggagctctgcg 3' Primer Sequence: cagattctgaatctccgattggaaaaactc
PCR Condition: Step 1, 98C 30 sec melt, 1 cycle; Step 2, 98C 10 s
Nucleotide Sequence: AuGGuGGAGCuCuGCGGCGGCGAGGGGGAGGGGCAGAuCAuGCuGGCGACGGAGCuGGCCCAGCuGCGGGCCAuGGCGAGGGAGCuGGAGGCGAAGAuGGACCCGGACAGGGuGGCCGCGCGGGAGCuCuGCAGGGCGCuGGCGuCGuCCGuCGACCGGuCCAuCCGCCuCGCCGCGuCCuGCuuCCCGCCGCCGGAGCACCCGCCCCCCGCCGCCGGCAAuGCCGGCAGGGACGCCGCGuuCAAGAAGAGGAAGGGGAuGGCCAAGGuGAGGAGGCAGGuGAGGGuGACGuCGGuGCAGGACACGGCGuCGCuGGACGACGGCCuGAGCuGGAGGAAGuACGGCCAGAAGGACAuuCuuGGCGCCAAAuACCCGAGGGCCuACuuCAGGuGCACuCACCGGCACACGCAGGGAuGCAACGCGACCAAGCAGGuGCAGCGCGCCGACGGCGACCCGCuGCuCuuCGACGuCGuCuACCuuGGCGACCACACCuGCGGCCAGGCCGCCGuCGCCGCCGCCGCCCAGAGCGCGCCGCCCGAGCAuGCCGGCCAGGAGCAGCAGAGGCAGAGCuCGCuGCuCGCuGCGGGAACGGAAGGAAuuCAuCAGCAGGuAGuGGCAGAGCCuAuGGCGGCGCCGuuCuuGuuCACCuCGACGGCGGCCGGCGGCGuCGACGACGGCuACuuCuCCuuCAuCuCGCCGGCGAACuCCGACuGCCAGuuCAGCAGCGACuuCuCGGCGGGCAGCGuCGGGGuuGACAuGGACCACGAGGCuCGuuuCGAAGAuCuuuuCuCGAGCACuCuuGAGuuuuuCCAAuCGGAGAuuCAGAAuCuG
TFome clones do not contain stop codon at 3'end.
translation: MVELCGGEGEGQIMLATELAQLRAMARELEAKMDPDRVAARELCRALASSVDRSIRLAASCFPPPEHPPPAAGNAGRDAAFKKRKGMAKVRRQVRVTSVQDTASLDDGLSWRKYGQKDILGAKYPRAYFRCTHRHTQGCNATKQVQRADGDPLLFDVVYLGDHTCGQAAVAAAAQSAPPEHAGQEQQRQSSLLAAGTEGIHQQVVAEPMAAPFLFTSTAAGGVDDGYFSFISPANSDCQFSSDFSAGSVGVDMDHEARFEDLFSSTLEFFQSEIQNL