Tfome Clone Information

TFome Information for pUT1670

TFome Name pUT1670
Template
Genbank Insert ID HQ858861
Protein Name OsbHLH114
Species Rice
TF Family bHLH
Gene ID LOC_Os08g37730
transcript
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: 3' Primer Name: R236DN
5' Primer Tm (º C): 62.1 3' Primer Tm (º C): 62.0
5' Primer Sequence: caccatggcgttggaggcg 3' Primer Sequence: gctacagctctgcttctgctgctg
PCR Condition: Step 1, 98C 30 sec melt, 1 cycle; Step 2, 98C 10 s
Nucleotide Sequence: AuGGCGuuGGAGGCGGuGGuGuuCuCGGAAGGAuACuACuuCGGAuGCGGCGGuGCCAuGGCGGCGGAAGCAGCuGCAGGAGGAGCuuGGAGCuGGAGCCACGGGuAuGGCGGuGGCGuuGAuCAGGGGAAGGGGGCGAuGGAGuuAGuGGuGGACGACGGGGuGGuGAACGCCuuCuGGGACGGCGGCGGAGGCGGCGCAAGCuCuuCCCCGGuGAuGGCCGCCGuCuCGGGGuuuAuuGAGGAGCCGGACGGCGGuAAuuCCuCCGuCGCAGACGCAGCGCCGCCGCCGGAGCACGGAGGuGCGuCuGuCGuCGGACGGGAuGGCuCCGCGGCGGCGCCGGCGGCGGCCGCAGGGAGGAGGAAGCGGCGGAGGGCGAGGACCGuCAAGAACAGGGAGGAGGuGGAGAGCCAGCGCAuGACCCACAuCGCCGuCGAGCGCAACCGCCGGAAGCAGAuGAACGAGuACCuCGCCGuGCuCCGCuCCCuCAuGCCGGCCuCCuACGuGCAAAGGGGCGACCAGGCGuCCAuAAuuGGCGGAGCAAuCAACuACGuCAAGGAGAuGGAGCAGCuuCuCCAAuCCCuGGAGGCGCACAGACACGCCCGCCGCGCACGCACCGACGCCGCCGCCGCGuuGCCAuuCGCGGGCuuCuuCACGuuCCCGCAGuACuCCAuGAGCGCCGuGCCCACGACAACCACCACCACuGuAGCAGCAGCAGCAACGGAAAACGGCAAuGCCGuCGCCGGCGCCGGCGCGGGCGACGACGCGGACGCGGACGuGuCGGGGuCGAAGCCGuCCuCGGuGGCGGACAuCGAGGuGACGAuGGuGGAGAGCCACGCCAACCuGAAGGuGCuGuCGCGGCGGCGGCCGAGGCAGCuGCuGAGGAuGGuGGCAGGGCuGCAACACCACCGCCuCGCCGuGCuCCACCuCAACGuCGCCAGCGCCGGCCACAuGGCuCuCuACuCCCuuAGCCuuAAGGuGGAAGAAGACuGCCAGCuCACGuCGGuGGACGACAuCGCGGCGGCGGuACACGGGAuCGuCGAGACGAuCGAGCAAGAGCAGCAGCAGCAGCAGAAGCAGAGCuGuAGC
TFome clones do not contain stop codon at 3'end.
translation: MALEAVVFSEGYYFGCGGAMAAEAAAGGAWSWSHGYGGGVDQGKGAMELVVDDGVVNAFWDGGGGGASSSPVMAAVSGFIEEPDGGNSSVADAAPPPEHGGASVVGRDGSAAAPAAAAGRRKRRRARTVKNREEVESQRMTHIAVERNRRKQMNEYLAVLRSLMPASYVQRGDQASIIGGAINYVKEMEQLLQSLEAHRHARRARTDAAAALPFAGFFTFPQYSMSAVPTTTTTTVAAAATENGNAVAGAGAGDDADADVSGSKPSSVADIEVTMVESHANLKVLSRRRPRQLLRMVAGLQHHRLAVLHLNVASAGHMALYSLSLKVEEDCQLTSVDDIAAAVHGIVETIEQEQQQQQKQSCS