Tfome Clone Information

TFome Information for pUT1677

TFome Name pUT1677
Template
Genbank Insert ID HQ858868
Protein Name OsbHLH22
Species Rice
TF Family bHLH
Gene ID LOC_Os01g67480
transcript
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: 3' Primer Name: R211DN
5' Primer Tm (º C): 55.8 3' Primer Tm (º C): 59.8
5' Primer Sequence: caccatgaacaggatgacgg 3' Primer Sequence: gcaatcgtgcttgcctgagc
PCR Condition: Step 1, 98C 30 sec melt, 1 cycle; Step 2, 98C 10 s
Nucleotide Sequence: ATGAACAGGATGACGGCGCCGCACGGGGGGATGCCGCCGCCGCCGATGCCGGCGGCGGGGGGGCTGGCGAGGTACGGCTCGGCGCCGGGGTCGCTGCTGGCGTCGATCGCCGACTCGGTGATCCGGGGCCGCGGGGTTGGGGTTGTCGATCAGCTGCATCATCATCAGCATCAGCATCAGCTTCCGCCGCCGCCGCCGCCGCAGCAGCAGCAGATGGTGGGGAGGTACTTCTCCGCGGAGTCGTCGGGGCTCACCTCCTGCGAGTCCAGCTGCCGGACGACGACGACGACGTCCACAGCGGCGGCGGCCGATGTCGGGCGGCACCCGCTCGAGCGCGCGTACGGCGGCTCCGGCGAGATCCACGTCGACGCCTCCTCCGCCGCCGTCCCGCTCTTCCGCCACAGCAGCTCCCCCGCCGGCCTCCTCTCCCGCCTCATGGCTGACCCGCACGGCAATGGCATGGCCGCGACGAGAGGGATGGGCGGCTACTCCGGCGGCGGCGGCGACGCCGGCGCGATGGCGCACAGGAGGCTGAGCTCGCAGTGGAGCTTCTCGCGGCAGGACCTGCCGCAGATATCGGAGATGGGCGGCCTCATCCCCGACATCGGGGAGAGCATCGTCACCGGCGGCGGCGGCAACAGCTCCAGCAATGGCGCCGGCCACGGCGCGCAGTCCTCCTCCTTCCTCTCCTCCAGGAACTTCTCCATGAGCTCCTGGGACGACACCAACTCCATCATGTTCTCGCCCCCGAGCAGCAGCAAGAAGGCCCGCGTCGCCGCCGCCGCCGCCGGCGACCACGGCGACGACATGGTCTCCAGCTTCAGCAACATCGACTCCCAGTTTGGCTTGTCGAAGCAGTCGTCGCTGGAGATGGCCGGCATGGATGACTTCTTGCAGCTCCAGCCAGACTCCGTCGCCTGCAGGGCCCGGGCAAAGCGCGGCTGCGCGACGCACCCGCGGAGCATCGCTGAGAGGGAGAGGAGAACGAGGATTAGCAAGAGGCTGAAGAAGCTGCAGGATCTCGTGCCGAACATGGACAAGCAAACGAATACATCAGACATGTTGGATATTGCTGTAACCTACATCAAGGAGCTTCAGGGCCAAGTTGAGAAGCTAAAACATGACCAAGCAAACTGCACTTGCTCAGGCAAGCACGATTGC
TFome clones do not contain stop codon at 3'end.
translation: mnrmtaphggmppppmpaagglarygsapgsllasiadsvirgrgvgvvdqlhhhqhqhqlppppppqqqqmvgryfsaessgltscesscrtttttstaaaadvgrhplerayggsgeihvdassaavplfrhssspagllsrlmadphgngmaatrgmggysggggdagamahrrlssqwsfsrqdlpqisemgglipdigesivtggggnsssngaghgaqsssflssrnfsmsswddtnsimfsppssskkarvaaaaagdhgddmvssfsnidsqfglskqsslemagmddflqlqpdsvacrarakrgcathprsiaererrtriskrlkklqdlvpnmdkqtntsdmldiavtyikelqgqveklkhdqanctcsgkhdc